by E. E. Giorgi
I shrugged. “You’re too smart even to be a feline.”
The answering machine was blinking again. I left it blinking, took my glass of wine and settled in the back porch to watch the fireworks from the Dodger Stadium. They crackled, hissed and whistled and turned the sky into a canvas of shimmering lights.
The Brunello was ok.
Damn it. The hell with the Brunello. It’s Diane I wanted. You can’t stop at just a sip of good wine, that’s a blasphemy. You have to get tight.
Diane had given me just sip. And man, did I want to get tight.
SEVENTEEN
____________
Dr. Frederick Lyons leans over his desk and squeezes his temples between the heels of his hands. He looks tired. He looks tired and old. Shards of shattered dreams lay all around him, their edges as sharp as a scalpel.
What happened to you, Dr. Lyons?
“What do you want?” he snarls, without bothering to lift his head.
Some things haven’t changed.
Just give him time.
“You’re b—back to work, D—Doctor. I didn’t think—”
“What do you want, Medina?”
Medina stiffens. He swallows bitter hatred. To the rest of the world, it looks like he just cleared his throat. To the rest of the world, he looks like a turtle peeking out of its shell. “The new draft, sir,” he says, softly. This time he manages not to stutter.
Lyons dignifies him with a stare. “What draft?”
“The PNAS p—paper. The s—second r—rev—”
“Reviewer,” Lyons snaps.
“Yes. He w-wanted to s-see more tests, so I r-ran those and—”
“Right.” Lyons draws in a sharp breath and leans back in his chair. His eyes glaze over. They seem sad, almost soft. What a heart-breaking view. “I asked Marianne to cancel my trip to Duke.”
“I understand—”
“And then I told her not to.”
Medina doesn’t reply. He squints and looks at the world through the small opening of his shell.
“They can’t stop me,” Lyons says. “Not like this. They won’t stop me like this.”
“Yes, s—sir.”
Lyons’s eyes focus back, sharply. “I need a dozen slides by next Wednesday.”
Medina stiffens. He swallows, again, then tiptoes to the desk, where he leaves the paper draft he’s brought along.
“A dozen should suffice,” Lyons goes on, his eyes glazing over again. Outside, a jackhammer rattles. A crane looms over the scaffolding across the street. “Show a couple of your neat graphs. Explain the algorithm, you know it best. The usual stuff.”
“Yes, sir.” Medina shuffles back to the door. “Oh, and s—sir?”
“Yeah?”
“My deepest condolences.”
Lyons frowns, taken aback. It’s just a moment and then he turns away, his eyes lazily following the block of cement dangling out the window.
My deepest, deepest condolences.
Medina limps down the hallway. His feet hurt, his hands prickle.
Damned moths, they suck the life out of me.
A dozen slides, your usual graphs. Explain the algorithm, you know it best.
Of course I know it best. It was my idea to begin with.
He shuffles down the hallway back to his office. Nurses walk by. Lab technicians chat in the elevator lobby.
Nobody talks to Medina. Nobody seems to even notice he’s there.
Until they need something from me.
Medina the stutterer, the loser, the poor dude with the invalid mom.
Medina, the one they all pity.
He sits at his desk and logs into his machine.
The alignment he’s been working on opens up, mismatched columns of colors.
Four colors.
He reads the first line.
CAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGACGCAACCACCACTCTATTT…
No, wait. His eyes run back to the beginning of the line. He starts reading again.
CAAATTGTGGGTCAC…
That can’t be right. He jumps to the next line.
CAAATTGTGGGTCAC…
Damn it, an insertion. Stupid insertion made the whole region a stutter. Screwed up the whole alignment. Fucking software, if only there were one that did the job right. What’s the point of having machines if all the dirty work has to be done by hand?
He clicks on the edit tab and starts typing. Then he stops. A bright red drop sits on the A key. Another one drips on the G. The Space key is smeared.
Damn it.
He reaches for the Kleenex box, plucks out a tissue, wraps it around his left hand.
Damn it, damn it, damn it.
He wipes the keyboard clean, starts over. Menu, edit, insert gap column.
He stops, again. His hand hurts. He opens his fist, the Kleenex on his palm a clump of bloody shreds. Carefully he peels them off his skin and tosses them in trashcan. He examines the inside of his hand. Tiny lesions crowd at the base of his thumb and pinky. He balls his hand and fresh blood oozes out.
He squints.
Fresh blood and crawly, hairy legs, tiny spider legs, thousands of them, oozing out of his open skin like—
Argh!
He jumps out of his chair and leaps to the door.
Breathe. Just. Breathe.
A beep from the computer makes him turn back to the screen.
“New message from lj66: Hey, would you look at this?” he reads on the monitor.
Medina takes a deep breath, shuffles back to his desk. He keeps his injured hand closed into a fist, while with the other he opens his inbox.
“Confidential data, I’m not supposed to send you this stuff,” he reads off the first line. John Wood, an old bloke from college. He works at TYU Labs now. They chat, from time to time. Nothing special.
What does he want now?
“Pseudogenes,” the email goes on. “I bet you’ve never seen them like this. You’re gonna love it.”
Medina clicks on the attachment. His jaw drops, his hand no longer hurts. He lets go of the Kleenex he’s been squeezing and picks up the phone.
“I knew you’d love the data,” he says. “It’s unbelievable, isn’t it? I wonder what it feels to have all this stuff going on in your body. You know, the normal genes, and then all the extra genes overlapping. It’s like—like that documentary on the Discovery Channel, the real superhuman, remember that?”
Medina thinks about it. Of course he remembers. Seems almost too good to be true. All he’s been looking for, for years …
What perfect timing.
He licks his lips and whispers softly into the mouthpiece. “Wh-who’s the data f-from?”
John doesn’t reply right away. He lowers his voice. “Um, listen. Blood came from a client, a geneticist down in San Marino. One of his patients. He wanted some dendritic cell tests, antibody titers, and peripheral blood PDCs. I found the gene expression tests from assays done on the patient last year. So, you know. I’m not supposed to share this stuff. It’s just a curiosity, I thought you might like it. Besides, the guy’s screwed. Look at those test results. He’s a battlefield of antibodies attacking all the tissues that express the supergenes. He’s toast. Nothing like what the documentary made you think.”
John chuckles, Medina doesn’t join in.
Medina’s thoughts are elsewhere right now. His fingers click on a terminal window, his brain fires with ideas.
Nothing’s anonymous once on the web, he thinks.
Nothing, not even firewalls.
And deep inside, he smiles.
EIGHTEEN
____________
Thursday, July 15
Dr. Cohen pointed the surgical lamp to my face. “What did you die of, Track?”
I squinted at the light. “I don’t know, Doc. I thought it was your job to find out.”
Cohen laughed his bubbly little laughter. It trailed off as quickly as a New Year’s Eve toast. Water ran from one of the faucets by the wall. The air sme
lled of formaldehyde, bleach, and cytological stains. It smelled aseptic and cold, a metallic tang that clung to the air like a hangover. It smelled of death.
“This is going to be fun,” Cohen said, hovering over me with the Stryker saw.
It didn’t look promising. It didn’t look fun, either.
“It’s the first time I get to actually talk to one of my patients. If you can call them patients, that is.” Cohen laughed and dug the saw into my breastbone. If the water of the Styx had a sound, it had to be that of a Stryker saw. Blood and warm chunks of flesh spattered on my face. I licked my lips. They tasted salty and rusty.
The hedge clippers came next. They cracked through my ribs like nutcrackers. Cohen’s puffy face pearled with sweat. “Sheesh, Track. You always loved to give me a hard time.”
I thought of apologizing but didn’t quite see the point.
He wiped sweat off his forehead with the back of his sleeve and stared into the hole he’d dug into my chest. It occurred to me then that he wasn’t wearing a facemask. “Now, that’s interesting,” he said.
I felt a little apprehension. When it comes to doctors, I don’t want to be interesting. I want to be as dull and boring as a Sunday mass recited in Latin.
Watanabe emerged through the darkness of the backlight. His face was yellow and grave and didn’t look too healthy either. He stared at the hole Cohen had dug through my chest and pursed his thin lips.
“Where’s his heart?” he asked.
Cohen craned his head. “I can see only some of it.”
“Makes sense,” Watanabe replied. “His antinuclear antibodies were off the chart. His immune system started attacking his heart until it eventually destroyed it.”
“A-ha,” Cohen said. He shoved his gloved hands inside my ribcage and pulled out a bloody mass. It was still pulsating, though slowly, its red walls rising and falling in long, tired sighs. “Well, of course. Look at that, it’s half-eaten. Why didn’t you tell me before, Track?”
“Tell you what?” I asked.
“It’s in V-Tach,” Watanabe said.
“That’s too bad,” Cohen sighed. “A strong heart. Strong indeed.”
“Tell you what?” I yelled.
Cohen tipped his head. “You didn’t have a human heart. You had a predator’s heart.”
A predator’s heart.
A predator’s…
I sprang my eyes open. A faint light crawled through the curtains and wavered on the ceiling. I inhaled. Sweat, my own. Carpet, dust, wood. My dust, my wood. A jay screeched outside. A neighbor rolled the trash bin down the driveway.
I brought a hand to my chest. It felt smooth—intact skin, a few hairs, no hole. My heart was still there, thumping against the breastbone.
My heart.
A predator’s heart.
The autopsy was a nightmare, but the conversation at Watanabe’s house had been real.
The blood work I’d done the week before had come back positive for some autoimmune disorder I didn’t understand.
“Does it matter, Doc?” I’d joked. “That my DNA was screwed up we knew already.”
“No, Ulysses, not your DNA. You are an epigenetic chimera—you express genes that are normally not expressed in other humans.”
And, apparently, that was exactly the problem.
Homer’s Ulysses had gone down to Hades to find out his fate. My fate instead had always been within me. In my blood. My oracle, my blind Tiresias, a Japanese American doctor who could read DNA like Ella Fitzgerald read a music score, told me my immune system was going berserk, attacking my own heart because it expressed genes the rest of my body did not recognize. It seemed surreal, almost a joke, yet Watanabe didn’t share my humor when I laughed at the news.
So I thought of something smart to ask. “How do we make it stop?”
“There’s only one way,” he’d replied. “We suppress the immune system.”
“What if we don’t make it stop?”
The absence of an answer was as hard as an untold sin.
Right, I thought, getting out of bed. Don’t take the fucking medication and your heart goes. Take the fucking medication and your immune system goes.
Watanabe’s prescription rested on my nightstand, unused.
Look at the bright side, Ulysses.
You get to pick your own ending.
* * *
The door looked ominous. It was crossed in red “biohazard” tape. Pictures ripped off some manga comic book plastered the glass pane. Satish knocked.
“Why’s the door closed?” I objected. “Every other office here at Electronics is open.”
Satish gave me a look that meant, “Wait and see.”
The door opened a crack. Loud rock music and the mildew-y smell of chilled sweat spilled out. A face emerged from the darkness—gaunt, unshaved, with a dark birthmark that sprawled from his right temple down to the outer corner of the eye. Somewhere, a Halloween costume was missing its face.
“Hello, Viktor,” Satish said. “This is my partner, Detective Presius.”
Viktor regarded us carefully, not moving a muscle except for the twitching of his ash-colored pupils. “Right,” he said, pulled his face back into the darkness, and closed the door.
I smiled. “So. That went well.”
Unscathed, Satish rocked on his heels. “Just remember not to call him Vik,” he whispered. “Pisses him off.”
The door opened again. The loud music had been silenced, not the smell. “I only have one extra chair,” Viktor said, looking at me. “Grab one from Dan.”
“Who’s Dan?”
“Guy next door,” Satish replied.
I found a metal chair, folded and abandoned in the hallway, and was then left with the arduous task of finding a spot in Viktor’s office.
Viktor’s office was dark, windowless, and filled with dust and the peculiar smell of old computers. Two long and narrow desks faced opposite walls, their surfaces completely buried with stuff. The only light came from a dim table lamp and the two side-by-side monitors that emerged above a general chaos of DVD cases, dirty mugs, programming books, and random pieces of electronics. Overhead lockers were open and stuffed with keyboards, laptop bags, and cases of Gatorades. I squeezed between the tables, unfolded the chair in the only free corner of the room, and sat down.
Viktor squinted at the code dribbling down his two screens, then turned to us, his smile as thin as paper. “You guys want the short answer or the long one?”
His voice seemed to brew somewhere at the bottom of his throat before coming out. It gargled in a shady, yet fluid way.
“Both,” Satish replied.
He nodded. “’Kay. Short: it’s not a language I recognize.”
I chortled without being amused. Everything about the Byzantine Strangler was an enigma: the ligature was a mystery, the fibers he shed unidentifiable, the origin of the tiles unknown, and now Viktor from the Electronic Unit, was telling us that the code printed at the back of the tiles found next to Laura’s body was yet another puzzle.
“I hope the long answer’s going to be a bit more helpful,” I said.
The thin paper smile evaporated. Computer experts can be as dogmatic as the Church and as obscure as the assembly instructions that come with Swedish furniture.
“I could elaborate,” he magnanimously offered.
“Please do,” Satish said.
“’Kay. It’s not a high-level language. One—could be some kind of micro-code, which runs inside the CPU or control code. Two—could be a cipher text, an encrypted message. Could be a plain encrypted code or have something hidden, like steganography. Or both. The feds have the best tools to crack these guys. I’d contact the RCFL in Orange.”
“The fibbies take their sweet-ass time with our evidence,” Satish grumbled. “That’s why we came to you instead.”
Viktor ignored him with the smoothness of a polished floor. “If it’s encrypted, there’s not much anybody can do unless the guy is stupid. So let’s assu
me it’s something else for now. The characters remind me of the output of a disassembler between a high-level language and a receiving device. Like the old HP 42 plotter.”
He pointed to a window on the screen, where he’d typed the symbols found at the back of the tiles. “This one, for example: #g 3 could stand for command group three, #cs .5 for a point-five character skew, and #lw would be setting the width. Problem is, those codes are no longer used. Today’s machines have switched to G-code.”
The hell of a long answer. He could’ve delivered it in Japanese, as far as I was concerned.
My partner scratched the white stubble under his chin. “Okay,” he said. “Okay. Does this help us in any way?”
Viktor’s computer started hyperventilating. It sounded like an airplane about to take off. “It helps some,” he said, while typing. “It tells us our man feels comfortable around computers. Perps usually leave messages behind because they want them to be deciphered. So, either we find the key or, eventually, he’s going to give us the key.”
I snorted. “That’ll work. How many murders do you think he’ll need in order to hand it to us?”
The paper-thin smile resurfaced. “It’s the reality of things.”
Viktor’s computer beeped.
I scooted closer. “Did it just exhale its last breath?”
“No, the machine’s fine. It didn’t find anything on last vic’s hard drive, though.”
“Laura Lyons?” Satish asked. “What was it supposed to find?”
Viktor paused the typing for a moment, then resumed. “The receiving device. I was looking for some kind of HPGL visualizer, like Visual Basic or similar. If I’m right, and this is the output of a high-level language, we should be able to find the receiving device. The obvious place to look would be the victims’ computers, but so far no luck.”
Satish leaned forward and stared at the screen. “I assume you looked at Amy’s hard drive as well?”
“Yes. Both work and home.”
“So, what now?”
Viktor’s hands dropped from the keyboard. His eyes remained on the screen. The birthmark sprawling from his temple down to the corner of his eye was dark brown with lighter lines inside. It looked like a computer chip, really, which was sort of ironic.
