She removed Glenn Dudley's brain, taking great care with the scalpel, cutting the nerves. The brain spread out on the cutting board. It resembled a silvery bag of jelly. The color amazed her. She touched the brain with her fingertips. Protected by the chain-mail gloves, her fingers didn't register the subtleties of the texture, but the brain almost melted under her touch.
With a scalpel, she took small chunks of the underside of the brain and tucked them into biosample jars. 'I'm going to take his eye, Dr Nathanson,' she said. He nodded.
Using a forceps and scalpel, she lifted Dudley's eyelid and chipped and cut bone around the orbit of his right
eye. Eventually she freed up the eyeball and lifted it out of the socket. A bit of optic nerve dangled from it. She put it in the stock jar.
Austen made triple sets of samples. One set was for Walter Mellis to carry back to the Level 4 hot labs at the C.D.C.; one was for USAMRIID, at Fort Detrick; and the third set was for Reachdeep.
When they had finished collecting samples and the postautopsy cadavers were back in the crypts in their bags, the two pathologists exited from the morgue truck and went into the autopsy decon room, where they sprayed their suits down with bleach, using hand-pump sprayers. Mark Littleberry supervised the deconning process. They disposed of their suits in biohazard bags. Then Dr Nathanson returned to the O.C.M.E. by helicopter. The autopsied bodies of Peter Talides and Glenn Dudley would have to remain in the refrigerated truck for the time being. They could not be given burial or cremation. They had become federal evidence. The murder weapon was inside their bodies.
Alice Austen carried a box of sample jars containing tissue from the autopsies into the Reachdeep laboratory area. She entered the Level 2 decon vestibule, where she had to suit up again before proceeding inward. She put on a black biohazard suit, marked with the letters F.B.I. She put on lightweight rubber boots and double rubber gloves, and a Racal hood over her head, and then she pushed through a door into the Evidence Core. Hopkins and Lesdiu were bent over the two cobra boxes, which sat on a table under bright lights. Both men wore F.B.I. space suits.
Austen's sample jars contained fresh brain tissue, liver tissue, spinal fluid, vitreous humor from the eye, and blood. She gave the samples to Suzanne Tanaka, who
took them into the biology room for culturing, and for examination in the electron microscope. Austen went with her.
Tanaka wanted to try to make the virus grow in flasks of living cells. If she could get it to grow, then it could be studied more easily. Using a simple mortar and pestle, she mashed up a bit of Glenn Dudley's brain and dropped the mush into a series of plastic flasks containing living human cells. The flasks were used for growing viruses in culture. The virus in Dudley's brain tissue might infect the cells in the culture, and the virus would multiply in the cells, until the flask was enriched with virus particles. Then she could put a sample of it in an electron microscope and see the particles. The shape and structure of the particles might help identify the virus.
Nearby, Tanaka had some clear plastic boxes that held white laboratory mice. She made a water preparation of Dudley's brain tissue and injected it into several mice. 'This is our mouse biodetector system,' she explained to Austen. Mice are used in virus labs somewhat like canaries in a coal mine. When you are trying to identify a virus, you may want to inject it into mice. If the mice get sick, you can observe the signs, and then examine the mice by necropsy (that is, kill the mice, cut them up, and look at the mouse tissue through a microscope). 'We'll see if they get sick,' Tanaka said.
Next, Tanaka prepared some samples for the electron microscope. She wanted to try to make a direct image of the virus particles in Glenn Dudley's brain. Working with a scalpel, she cut away tiny bits of brain tissue. Her cuts made samples of brain the size of pinheads. She put the samples into small test tubes and filled the tubes up with a fast-drying plastic resin. The resin would penetrate the brain sample and harden it. Then Tanaka could make slices of it.
She also wanted to look at the powder in the cobra
boxes. She went into the materials room, where Hopkins and Lesdiu were still examining the boxes, and, with a fine pair of tweezers, she obtained a small amount of dust from the Zecker-Moran box, which she dropped into a tiny plastic sample tube. She poured quick-drying resin into the tube.
All of the samples - brain tissue and dust - became fixed in a hard plastic resin. Now she had some small cylinders of resin. She cut the resin blocks with a diamond-bladed slicing machine known as a microtome. A microtome is somewhat like a deli's meat-slicing machine, except that the blade is a diamond and the slices it makes are the size of the head of a common household ant. While she worked, she explained to Austen what she was doing.
'Investigations like this get me really fired up,' she said. 'I can hardly sleep when we're on a big case.' 'Have you been on big cases before?' Austen asked her. There was a little pause. 'Well,' Tanaka said, 'not really. I've ... dreamed about this, Alice. It feels like what I've wanted to do all my life.'
Tanaka placed the slices on copper sample screens that were the size of this letter o. 'Do you want to look with me, Dr Austen?'
'Yes.'
'Let's look at the Cobra dust first,' Tanaka said. She dropped a copper-screen sample into a sample holder, a kind of steel rod. She slid the holder into the electron microscope, and it made a clinking sound as it locked into place. She threw some switches, adjusted a dial, and a screen glowed. Tanaka dimmed the lights in the imaging room so that they could see the images on the screen more clearly.
In the materials room, Hopkins performed a delicate operation. With a fine pair of tweezers and a hand-held
magnifying glass, he took a nearly invisible pinch of dust out of the Zecker-Moran cobra box. He had a hard time seeing what he was doing - his Racal hood interfered with the view. He dropped the dust into a plastic test tube that contained a few drops of salt water and a disinfectant. The tube was about the size of a circus peanut.
Two rooms down, in the darkened imaging room of the Evidence Core, Tanaka and Austen looked into the screen of the electron microscope. Before their eyes hovered an image of the dust particles in the cobra box. Tanaka spun the dials, and the image moved sideways. She was scanning. 'This is weird,' she said. The particles were angular crystals. They had slightly rounded sides, rather like angular soccer balls.
'That's not a virus,' Austen said. 'There's no way it could be a virus. The crystals are way too large to be a virus.'
Tanaka found something inside a crystal. She zoomed the image, moving into the field.
'Look, Alice. Look at that.'
There were dark rods of material inside the crystals. The rods were scattered about. In places they formed bundles.
Tanaka pointed to a bundle of rods. 'Those - I'd bet those are the virus particles themselves. They're surrounded by these crystals. You've got virus particles embedded in crystals.'
'What do you think the crystals are made of?' Austen asked.
'I don't know. They appear to be a protective coating around the virus particles - if those little rods inside the crystals are virus, which I think they are.'
Tanaka put another sample in the electron microscope. 'We're looking inside one of Dr Dudley's brain cells,' she said. She spoke of his cells in a personal way,
as if she might be speaking of a hand or an arm. The crystals inside the cells were chunks of material sitting in the cell's nucleus. Some of the crystals were cracking open and seemed to be releasing particles into the cell's cytoplasm, the cell's interior. The particles resembled rods or batons. In places, Tanaka found the rods floating around inside a brain cell without any crystal material near them.
'Dr Dudley's brain cells are a mess,' Tanaka said to Austen in a low voice. 'This is as bad as Ebola.' 'Have you seen Ebola?' Austen asked.
'Sure. Part of our training. This isn't Ebola.' 'Do you think you know what it is?'
'I'm not ready to say, Alice. I think I know.'
&nb
sp; Austen was standing behind her, looking down at the screen. She felt dizzy, as if she were falling into the depths of a microscopic universe that extended inward to infinity.
'I have to be careful here,' Tanaka went on. 'There is a type of virus that makes crystals like this. It lives in butterflies and moths.'
'It lives in butterflies?' 'Yup,' Tanaka said.
Tanaka had brought reference textbooks with her. When you are looking at virus particles in a microscope, trying to make a visual identification of the virus, you check the images against photographs in a book, in the same way that a bird-watcher might look up photographs of birds in an Audubon field guide.
Tanaka went over to a military transport box sitting in a corner of the imaging room. She threw the catches, and pulled out a textbook on viruses. She closed the box and sat down on it, and opened the volume on her lap. Austen sat beside her. Tanaka flipped through the table of contents, then turned to a page about halfway into the
book. 'There,' she said, putting her finger on a photograph.
She had come to a section on insect viruses. The photograph showed images of crystals.
'This is nuclear polyhedrosis virus,' Tanaka said to Austen. 'That's kind of a mouthful. Let's call it N.P.V. You know, like H.I.V.? This is N.P.V. This virus scares the hell out of me.'
Austen saw that Tanaka wasn't kidding when she said the virus frightened her. Tanaka's breathing hood had misted up, a sure sign of upset. 'The crystals are a kind of protein, I think,' Tanaka said, her voice not strong. She said that the virus particles were clumped inside the crystals. 'The crystals are like - kind of - protective shells around the virus. They protect the virus from harm. This thing is an engineered weapon, Alice.'
Tanaka returned to the microscope and began snapping photographs with an electronic camera that was attached to it. Image by image, huge crystals appeared on a video screen. The two women looked at cells from the golden areas in Dudley's irises. The cells were full of crystals. It was the crystals, forming in the pupillary ring around the iris, that gave the eyes the yellow-gold color. There were crystals in the optic nerve leading to the eye. The virus had either migrated through the eyes into the brain along the optic nerve, or it had spread out of the brain to the eyes.
They were seeing a life-form that Austen.had seen earlier through the optical microscope in Glenn Dudley's office, when she had first looked at Kate Moran's brain tissue in a microscope. Then she had seen fuzzy shapes, without much clarity. Here, the clarity was superb, and the crystals loomed like planets.
'We have to tell Will,' Tanaka said.
The Code
Will Hopkins, now dressed in surgical scrubs but not a space suit, had set up a work area on a table in the conference room. While Tanaka was attempting to make an image of the virus particles, he would try to 'see' the DNA of the virus using his machines. In this way, he hoped to get a rapid identification of the virus.
He hooked up the two Felix machines on the table. He deployed several other small machines as well. He also put out a bagel with cream cheese, which he munched while he worked. Wires and cables trailed everywhere.
Hopkins had a sample of Cobra dust in a small plastic test tube the size of a baby's finger. The dust had been sterilized with chemicals and mixed with a few drops of water. It wasn't dangerous. It contained a quantity of DNA from the virus. He held the tube up to a bright light and swirled it around. Sometimes you could actually see DNA with your naked eye - it formed milky lumps in a test tube. This time, he couldn't see any, but the water in the test tube was nevertheless full of strands of DNA, like a soup made with angel hair pasta. He put a droplet of the water (containing DNA from the virus) directly into a sampling port in one of the Felix machines.
Felix began reading the DNA, but nothing came up on the screen. Felix was having some problems. Hopkins
had to resist a temptation to bang Felix with his hand, the way you'd bang a television that isn't working. Just then Austen and Tanaka came in. Tanaka's face was radiant, she was beaming, but holding back.
'I'm having trouble getting gene sequences here,' Hopkins said to them.
'Take a look at this,' Tanaka said. She laid the photographs in front of Hopkins.
'Whoa,' he said. He stared at the photographs, chewing bagel.
'These are particles we recovered from Glenn Dudley's brain,' Suzanne Tanaka said.
'Midbrain. The part of the brain that controls primitive behavior, such as chewing,' Austen added.
'Look at the crystals, Will,' Suzanne Tanaka said. 'See that blocky shape? This looks like the nuclear polyhedrosis virus. N.P.V., which lives in butterflies. It isn't supposed to live in people.'
Hopkins stood up slowly, a look of wonder on his face. 'It lives in people now,' he said. 'My God, Suzanne! A butterfly virus. This is great!' He slapped her on the back. 'Suzanne, you are the best!'
She looked very pleased. She didn't say anything. 'All right!' Hopkins said. 'All right.' Now he paced the room. He ran his hands over his face. 'All right. What are we gonna do, guys? Are we going to tell Frank Masaccio we've got a butterfly virus? He won't believe us. He'll think we've gone lunatic.'
In biology, the shape of an organism may not tell you how it fits into the evolutionary tree of life. Many viruses look alike in a photoscope but are very different at the genetic level. 'We need some genes,' Hopkins said. 'We need a gene fingerprint. Felix is gonna prove this thing is a butterfly virus. I'm scanning genes already, but I haven't put it together.'
He bent over the Felix machine, his hands flying, working like a madman.
Austen found herself watching Hopkins's hands as he worked. His hands were muscular, but they were gentle and precise in their motions. There was no trembling, no hesitation, no spare or useless movement. His hands were in perfect control. These were trained hands, the hands of a gadgeteer. 'I'm purging the system. We'll try again.'
Using a micropipette, he put another sample of DNA into Felix. Still standing, he tapped the computer keys, and letters of text began to appear.
ttggacaaacaagcacaaatggctatcattata gtcaagtacaaagaattaaaatcgagagaaaac gcgttcttgtaaatgcctgcacgaggttttaa cactttgccgcctttgtacttgaccgtttga ttggcgggtcccaaattgatggcatcttta ggtatgttttttagaggtatc
This was genetic code from somewhere in the DNA of the Cobra virus.
Molecules of DNA resemble a spiral ladder. The rungs of the ladder are known as the nucleotide bases. There are four types of bases, and they are denoted by the letters A, T, C, and G. (The letters stand for adenine, thymine, cytosine,, and guanine - nucleic acids.) The length of the DNA in living creatures varies greatly. Human DNA consists of about three billion bases. That's enough information to fill three Encyclopaedia Britannicas. All of this information is crammed into every cell in the human body. A small virus, such as the virus for the common cold, has only about 7,000 bases of DNA. Hopkins had made a guess that the Cobra was complicated and would probably contain around 50,000 to 200,000 bases of DNA.
Sometimes as few as a dozen bases of DNA code are
enough to provide a unique fingerprint to a particular organism. You can use a computer program to match unknown code with known code. If you can make a match, then you can identify the organism the DNA came from. The process of matching unknown DNA code with known code is like the process of opening an unread book and reading a few lines from it. If the lines are familiar, then you can make a guess as to the book. For example, these words serve to identify a book: In the beginning God created the heaven and the earth. And the earth was without form, and void. The exact edition of the book (the 'strain' of the book, so to speak) is the King James translation of the Bible in English.
As strings of letters marched across the screen, Hopkins hoped that he would soon have a better idea of what kind of book Cobra was.
gcaagcatttgtatttaatcaatcgaaccgtgcact gatataagaattaaaaatgggtttgtttgcgtgttg cacaaaatacacaaggctgtcgaccgacacaaaaat gaagtttccctatgttgcgttgtcgtacatcaacgt gacgct
The letters drifted in blocks acro
ss the screen. 'Time to get on the Web,' Hopkins announced. He ran Netscape on one of the Felix laptops. His computer then socketed into the World Wide Web via the satellite dish sitting on the patio deck. In a few seconds, he arrived at a Web site known as GenBank. This site - it is in Bethesda, Maryland - has a huge database of genetic sequences. GenBank is the world's central library of genetic codes.
Hopkins clicked a button on the screen. The GenBank computer looked at the code and began matching it to known genetic codes. Soon an answer came back:
Sequences producing High-scoring Segment Pairs: Autographa californica nuclear polyh. . . 900 4.3e-67 1
Autographa californica nuclear polyh. . .900 4.9e-67 1 Bombyx mori nuclear polyhedrosis vir. . . 855 2.4e-63 1 Bombyx mori nuclear polyhedrosis vir. . . 855 2.7e-63 1
It was a list of virus DNA codes that had shown close matches with the code that Hopkins had sent. The top line showed the closest match.
'Looks like we've got a rough identification of the Cobra virus,' Hopkins said. 'That top line, right there, that's the probable strain of the virus. That's the closest match to Cobra.' His finger traced over
Autographa californica nuclear polyhedrosis virus Cobra virus was similar to the nuclear polyhedrosis
virus, or N.P.V. (It is also called the baculovirus.) This particular strain lived in a moth. The moth was Autographa calijbmica, a small brown and white moth that lives in North America. The caterpillar of the moth is a crop pest, a green inchworm known as the alfalfa looper. The virus invades the moth caterpillar and kills it. Cobra was based on a moth virus, but it had been altered.
N.P.V. is a common virus used in biotechnology labs all over the world. It is available to anyone, and Hopkins's heart sank as he thought about this. The virus was going to be devilishly hard to trace back to its original source. It made him wonder if his idea of a Reachdeep operation was already in trouble.
The crystals that Tanaka had photographed were actually crystals of protein, with virus particles embedded in them, like seeds in a watermelon. The protein is called polyhedrin, because it forms rounded crystals that look like soccer balls: polyhedrons.
Cobra Event Page 19
