“Well, I was just thinking…. Maybe you need to feed it two genomes.”
“Two genomes.”
“Well, after all, it takes two genomes to make a baby—the mother’s and the father’s. Maybe the program needs the same ^‘i number.”
Elder rubbed his chin and gazed into the middle distance. Anne felt embarrassed; she wished she had kept her mouth shut. Then his eyes lit up. “You’re a genius,” he said. “And I’m an idiot.
You’re right. I’m sure you must be. Let’s try it.”
Elder bent forward, grabbed the stack of disks he had borrowed from the hospital, and sifted through them. He found a male and a female genome, popped the disks into the computer, and fed their data into the program. When it had accepted all the data, a question appeared on the screen:
MALE OR FEMALE (M/F)?
“Look. It’s acting differently already. It’s asking us whether we want a boy or a girl.” Anne came and stood behind the doctor, peering at the screen over his shoulder.
“Let’s have a boy,” she said. She felt an impulse to rest her hand on the doctor’s shoulder, but resisted it.
Elder punched the “M” on the keyboard. A new message appeared: SELECT PARAMETERS (or strike ENTER for preselected norms).
Elder struck the “Enter” key through a long list of coded parameters that meant little to him. When the list was exhausted, the program followed with these questions:
STORE TO DISK? (Y/N)
PRINT OUT? (Y/N)
Elder punched “Y” for the first, “N” for the second.
TEST TRIAL OR APPLICATION? (T/A)
Elder punched “T.”
“Please Wait” flashed on the screen, and Jupiter began working on the data.
“I’m worried about this taking up so much of your time,” Anne said.
Elder shrugged. “I don’t need much sleep. Even if I did, I couldn’t pass this up.”
“I was thinking—maybe I could help you.”
“You already have.”
“No. I mean with your work. Help you around the office. File things, type things. You need a secretary desperately. Carmen’s a great nurse, but she spends half her time answering the phone and looking for misplaced records. I could do that. And I could keep your appointments book for you.”
Elder seemed alarmed by the idea. “But that’s . . . I couldn’t let you do that.”
“Why not? You can’t deny you need the help.”
“No, but . . .”
“And I won’t cost you anything.”
“No, no. I couldn’t let you.”
“Yes you could. Look, Doctor, I need your help. So let me do something in return.”
Elder kept shaking his head. “No, no. I’m sorry. I appreciate your offer, it’s very generous, but . . .”
“Will you at least think about it?”
Elder looked relieved. “Okay.”
Anne fell silent. She went back to her chair. It was a good idea, she thought. Why did he resist it? It seemed to scare him. She shouldn’t have put him on the spot like that. He could have excellent reasons that were none of her business. She knew nothing about his life. What was the matter with her? They had been getting along so well. She hoped she hadn’t alienated him.
“Besides,” Elder said, pretending to study a manual that was propped open next to the computer, “what would you do with Genny?”
“She has a full-time nanny, paid for by her father, so she’d be perfectly fine at home. But if it was okay with you, I could bring her with me—some of the time, anyway. She’d love it. You know she’s very well-behaved. And she’d be so happy to be around some other children.”
Anne saw how conflicted he was, but she had the feeling that he wanted her to persuade him. She looked at him pleadingly.
“Will you try it? For a week? If you don’t think it works after a week, just say so. I won’t complain. I promise.”
“Okay.” Elder let out his breath in a long, ragged sigh. He seemed suddenly disgusted with himself. “Hell, yes,” he blurted out. “I’d like you to do it. Having you here helping me would be great. I don’t know why I have such a hard time admitting it. I guess I just don’t expect anything from anybody.”
“Sounds just like me,” Anne said.
“Why?”
“That’s my life story: don’t expect or demand anything from anyone and you’ll never be disappointed. I found out it didn’t work. I was disappointed all the time.”
Elder grinned. It was the warmest smile she had yet seen from
.
. 1
,
:;
, j r
.;,
him. “I thought you were probably pretty demanding,” he said.
“And rich and spoiled?”
“That crossed my mind, too.”
“Well, I’m not. I married a man who was rich and spoiled.”
“Ah.”
“I grew up poor in Vermont.”
Elder laughed.
“What’s funny about that?”
“Where in Vermont?”
“Near Burlington.”
“I grew up in Hartland. Now that’s really the sticks.”
“You did? My God! I thought you were a native New Yorker.
What happened to your accent?”
“I lost it somewhere in medical school, I guess.”
“What about family?”
“My folks still live in the house where I grew up. Mom taught grade school, Dad ran a garage. Pretty ordinary people. I go up and see them three or four times a year. I’m their only child.
They’re pretty proud of me. First doctor in the family.”
An urgent beeping from the computer interrupted them. Elder turned to the keyboard and called up Jupiter’s results. He printed out the first ten pages of data from each of the two genomes he had fed into the machine, and ten pages from the new genome the program had created, and placed the three sets of fanfold paper side by side on the floor, to compare their contents. Anne knelt on the carpet beside him.
“Progress,” he said, after a short look. “God knows what the program has created, but at least it’s different from the two that we fed into it.”
Anne gazed at the long accordion folds of paper in complete bafflement.
All she could see were endless rows of letters, spelling out nothing.
“How can you tell anything from that?”
“I can’t. Not yet, anyway. But you can see that the code is different in places.” The doctor pointed to a row of letters he had underlined on the same line of the third page of each of the three sets: ACCTCAGACTGTCTTCACGGTCTAGTCGATCGATCG
ACCTCAGACGGAACGCACGGTCTAGTCGATCGATCG
ACCTCAGACCTCCAACACGGTCTAGTCGATCGATCG Anne sat back on her heels. “I see the difference. Is that all there is on all these pages? Just endless rows of A’s, C’s, T’s, and G’s?”
“Yup. That’s all.”
“What can it possibly tell you?”
“Just about everything. It’s a complete set of instructions for building a human being.”
Anne expressed amazement. “How many pages would there be if you printed out the whole thing?”
Elder scratched his chin. “I don’t know. Hundreds, I guess.”
“Well, why only four letters?”
“The letters stand for four different nucleotides—adenine, guanine, cytosine, and thymine. They make up the billions of base pairs that form the double strand of the DNA molecule.”
Anne frowned. “I should know that, shouldn’t I? I mean, I majored in biology, after all. But genetics wasn’t emphasized that much. Gregor Mendel and his pea plants is about all I remember.”
“Biology has come a long way since you were in college-which couldn’t have been very long ago.”
Anne flushed. It was the first time Elder had ever made any direct comment about her. Was he being complimentary or condescending? “Is it too late for me to catch up?”
“Of course not. The basic concepts
haven’t changed. But there’s been enormous progress—new discoveries, new terminologies, new techniques.
I’m not very current in the field myself. It’d be a full-time job just keeping abreast of it all.”
“Will you . . . could you just review some of the basics for me?” It was unlike her to make demands like this on anyone. The impulse surprised her, but she didn’t back away from it.
“You might find it tedious.”
“No, no. I sure I won’t.”
1
.
Elder scratched his chin again. “Well, where to begin? Maybe a quick, simplified overview. Every cell in the human body contains a command center of sorts, a nucleus. You probably remember that from—’ “I don’t think blood cells have nuclei,” Anne interrupted.
Elder nodded hastily. “That’s right. Blood cells don’t. But most others do. Anyway, inside each nucleus there are chromosomes-little wormlike clusters of specialized molecules made up of deoxyribonucleic acid, or DNA. We have forty-six of these chromosomes altogether.
Everybody’s are the same, except males have an X and a Y chromosome, females two X’s. These forty-six chromosomes carry all the human genes. And we still haven’t found them all. The latest count puts the number at over 150,000. And these genes are not separate entities—they’re really just special stretches of DNA code on the chromosomes, each assigned to perform a specific function. No, correct that—each carrying its own set of directions for how to assemble and operate a specific part of the human body. Taken together, the genes make up what we call the human genome. They contain both the blueprint and all the operating instructions for a human being.”
Elder picked up the textbook Anne had been reading and found a page showing a diagram of the DNA molecule.
“Each chromosome consists of two extremely long and extremely thin parallel strands of DNA. The strands don’t lie straight. Imagine a long rope ladder twisted in a clockwise spiral over and over again until it resembles a tightly knotted bundle of cord, and you’ll have a pretty fair picture of what a strand of DNA actually looks like. The rungs of that DNA ladder are formed by these four nucleotides. They bind together in what are called base pairs, two to a rung. But they don’t bind in any old fashion. Adenine binds only with thymine, and guanine only with 1 cytosine.”
Anne looked directly into Elder’s eyes. “Why is that?”
Elder lowered his own gaze. “Hard to say. Probably because of the way the molecules are shaped. In any case, that’s the way it works. So those computer printouts on the floor are some of these long sequences of base pairs. They’re coded instructions. A sequence can instruct the cell to manufacture a certain protein, say, needed in the blood, or the brain, or wherever. Let’s change the analogy from a ladder to a computer for a moment. As you probably know, all computer language code is built on a simple binary system—long strings of zeros and ones—or yeses and nos, or negatives and positives. When they’re put together in a certain order, they instruct a program to do something—to add two numbers together, or to shift one paragraph of type from one place in a manuscript to another place.”
“But how can such complicated instructions be composed from just zeros and ones? Or from just combinations of only four letters?”
“What the language gains by being simple, it has to compensate for by being extremely long. A single simple computer instruction can require a sequence of many thousands of ones and zeros. The same applies to our genome. The number of base pairs it takes to initiate a simple chemical reaction is considerable. The number of pairs required to create all our genes is in the neighborhood of three billion.”
Warming to his subject, Paul Elder regaled Anne with the processes of cell division, how DNA transfers its instructions via messenger RNA, how cells specialize, how genes were first discovered, how cells replicate themselves, and so on. In his enthusiasm, he shed his fatigue almost magically, becoming more alive and impassioned the longer he talked.
Anne listened with rapt attention. She knew she was being sinfully dishonest, but she couldn’t help it. She already knew everything he was telling her, and quite a bit more besides. But she wanted him to talk to her. She was happy just to be close to him, to watch his hands, his eyes, his expressions. As far as she was concerned, he could talk forever about anything at all.
She stuck in another question to keep him going: “Why is it that so little of the genome—these three billion pairs—is actually used to code for specific genes? What’s the purpose of all the rest of it—all these millions of pairs that seem to have no function at all?”
A peculiar expression—something between an embarrassed
.
,
,.
.
. .
. i, r !, i’ 1
I
I
. grin and a hurt look—transformed Elder’s features. “You know more about this subject than I do, don’t you?”
Anne laughed nervously and denied it. She realized that she had given herself away by asking him a question about something he hadn’t even described to her. Their eyes met briefly, then veered abruptly away, as if to avoid some kind of emotional collision.
Anne was experiencing the oddest sensations. She didn’t feel entirely in control of herself. Impulses she didn’t even know she had seemed to be taking oven-and she was blindly following them. It was as if some part of her that she didn’t know existed had decided to assert itself.
Elder glanced at his watch in shock. “My God. One o’clock in the morning! I’ve been yakking away like a damned maniac. Why didn’t you tell me to stop? You must be ready to drop.”
“I loved it. Really, I did.”
Elder stood up, took a deep breath, and shoved his hands in his pockets. “Well, anyway,” he said, sounding suddenly quite -i uncertain of himself, “those are some of the basics.”
He groped for something else to say. Anne gazed at him with anxious expectancy.
“Well, I’m sorry I went on so long, anyway,” he mumbled.
“You’re too polite.”
Anne felt giddy. A sensation of weightlessness took hold of her, as if she were in an elevator that had suddenly begun a rapid descent. Her heart was pounding, her skin prickled, her face burned, and she couldn’t catch her breath. “Do you like me at all?” she blurted out.
Elder tried to act as if he hadn’t heard the question. A tide of red advanced up from his neck and swept over his cheeks. He opened his mouth, but nothing came out.
“What I mean,” Anne continued, in a quavering voice, “is, well, I like you but maybe you don’t like me, and that’s okay, I certainly understand.”
“But of course I do like you,” he replied.
“Well, ‘like’ isn’t really what I meant,” she stammered. “I mean, what I really mean is—” Anne bit her lip. She jumped up from the chair, clutching her handbag and shaking her head. “I really must go. My God, I’m sorry.
I’m not throwing myself at you. Really I’m not. But you’re so … I never did this….”
She bolted out into his darkened outer office and fumbled with the lock on the door that led out into the building’s corridor.
Elder followed her, but she got the door open and dashed out into the corridor with the panicked fright of someone fleeing for her life.
“Anne. Wait.”
He ran after her out of the building lobby and onto the sidewalk.
“Wait. Let me get you a cab, for godsakes!”
She shook her head and set off down the block at a fast trot.
She glanced back. He was still following her.
“Anne! It’s late. You can’t go home by yourself at this hour!
Anne!”
Elder followed her for a block, where she hailed a taxi on her own and scrambled in. As the cab pulled away from the curb, she caught one last glimpse of him, standing on the sidewalk.
Back at her apartment, she slammed the door and leaned against it. Her heart was
pumping furiously.
Mrs. Callahan appeared from the back bedroom and snapped on the light.
“Are you all right, Mrs. Stewart?”
Anne nodded energetically. “Yes—fine!” she gasped. “Sorry if I woke you.”
“I heard the door slam,” the woman said, eyeing Anne suspiciously. “I was worried. It was so late and you not home yet. Are you sure you’re all right?”
“I’m perfectly okay. Please go back to bed.”
“Have you been running? You’re all out of breath. Did someone chase you?”
“No. I was just getting a little exercise. Please.”
Anne finally persuaded Mrs. Callahan that she was all right.
The woman returned to bed, muttering to herself.
Anne suffered through a long, sleepless night. At nine o’clock in the morning a package arrived by messenger. It was her RCD copy of the Jupiter program. In the haste of her emotional departure, she had completely forgotten about it.
There was also a note:
Sorry you ran out. Serves me right for being such a bore.
Hope you’ll forgive me.
Best, Paul Elder
5 Anne read the note over and over. She considered calling Lexy and asking her advice, then decided she had suffered enough humiliation for one twenty-four-hour period.
: It meant what it said, she decided. No more, no less. He was obliged to return the RCD, so he had thoughtfully included a polite note with it, trying to make her feel a little less embarrassed.
i And that’s all the note was—polite. No feeling in it at all.
Surely the man wasn’t so inhibited that he couldn’t have responded with a little more affection and warmth if he had wanted to. “Best”
indeed.
He might as well have said “Sincerely yours.”
Anne tore the note up and threw it away. She decided that if he called and said he wanted to see her again, she’d see him again.
If he didn’t, she wouldn’t.
She waited for the call for many days. Every time the telephone rang, her heart lurched.
r. But the call never came.
Dr. Laura Garhardt sat stiffly at attention as Baroness von Hauser thumbed through a thick, leather-bound folder, crammed with several hundred pages of neatly printed test results, including Xrays, sonograms, genome profiles, and medical interviews. The book represented the first comprehensive report on the twenty Romanian women who had volunteered for the pilot genetics program. The report covered the first five months of their pregnancies.
Tom Hyman Page 27
