We begin with a preamble describing how the genes work, elucidated for greater clarity by reference to the schematic diagram on page 314. This starts in 1953, when James Watson and Francis Crick famously discovered the structure of DNA to be a spiral staircase (or double helix).2 The two outer ‘banisters’ of the staircase are made up of two strands of sugar molecules – Deoxyribose – from each of which is suspended a parallel series of four types of molecule known as Nucleic Acids – Adenine, Guanine, Cytosine and Thymine (referred to by their initials AGCT) – arranged in sequence. The chemical bonds linking the two parallel chains of nucleic acids form the ‘steps’ of the staircase. The combination of the Deoxyribose and the Nucleic Acid steps gives us DNA.
The profound significance of this ‘staircase structure’ is that it is particularly well suited to the replication of genetic information every time the cell divides, as Watson and Crick described:
We imagine that, prior to duplication, the bonds [connecting the two parallel chains of nucleic acids or ‘nucleotides’] are broken and the two chains unwind and separate [the staircase, as it were, splits down the middle]. Each chain then acts as a template for the formation on to itself of a new companion chain, so that eventually we shall have two pairs of chains where we only had one before. Moreover the sequence of the pairs of nucleotides will have been duplicated exactly.3
The double helix of DNA consists of two parallel strands of deoxyribose sugar molecules, to which are attached a sequence of nucleotides – AGCT – arranged in threes. The genetic instruction for a protein is conveyed by a strand of messenger RNA (mRNA) that passes out of the nucleus into the cytoplasm, where it feeds its coded instructions into a ribosome or protein factory.
Next it is necessary to clarify the manner in which the nucleic acids (or nucleotides) form the ‘genes’ that code for the tens of thousands of different proteins (enzymes, hormones, etc.). Each protein is made up of a unique combination of twenty types of simple building-blocks known as amino acids. Alone, the four nucleotides (AGCT) could only code for four amino acids, but if they are arranged in threes (or triplets) – such as CCG or CGC or GCG or similar variants – there are actually sixty-four possible permutations, which is more than sufficient to code for one or other of the twenty amino acids. So a gene made up of ninety nucleotides arranged in threes will code for thirty amino acids that make up a single protein.
Finally, we need a mechanism by which the ‘message’ of the gene (the sequence of ninety nucleotides) is turned into the thirty amino acids that make up the protein. The section of DNA that includes the gene unravels and acts as a template for the building of a parallel sequence of nucleotides, known as messenger RNA (or mRNA) because it carries the message of the gene. The mRNA passes through the wall of the nucleus out into the cytoplasm of the cell, where it is picked up by a protein-making factory, a ribosome. Like a ticker tape, the mRNA feeds itself into the ribosome, which reads off the first triplet of nucleotides and then pulls in from the immediate vicinity the relevant amino acid for that triplet. It reads off the next triplet and then pulls in another amino acid, and so on. So, from a gene made up of a sequence of ninety nucleotides one gets a unique arrangement of thirty amino acids that makes up one protein molecule.
This then, in a grotesquely oversimplified outline, is what Francis Crick described in 1958 as the ‘central dogma’ of genetics: ‘DNA makes RNA makes protein’.4 The corollary is obvious. The fault, or mutation, in genetic diseases arises because of a faulty arrangement of the sequence of nucleotides of the gene. This results in a faulty message being transmitted by the mRNA, leading to a faulty arrangement of amino acids, causing the faulty protein, which in the case of the genetic disease cystic fibrosis results in damage to the lung, and in Huntington’s chorea results in degeneration of the nerve cells in the brain.5 It is impossible to convey the scale of the intellectual problems that had to be surmounted before this mechanism of gene action became clear, nor indeed to describe the sheer sense of excitement experienced by the scientists over the fifteen years that it took to work it all out. Nonetheless it is important to appreciate that as of 1970 this understanding of the workings of DNA had no practical application at all, nor indeed did there seem to be the slightest prospect that it might. The molecular biologists had established this mechanism by which the gene acted – ‘DNA makes RNA makes protein’ – from experiments on the bacterium E. coli, but the ‘details’ of the individual genes remained completely inaccessible, concealed somewhere in the virtually infinite amount of information encoded within DNA, compressed into the virtually infinitely small space of the nucleus. Christopher Wills, Professor of Biology at the University of California, draws an appropriate analogy:
I have just with some difficulty hefted Webster’s Third New International Dictionary onto my lap. This is the one that you see in libraries, sitting proudly on its own little lectern. I find there are about sixty letters to a line, 150 lines to a column and three columns to a page. This works out at 27,000 different letters to a page. The dictionary has roughly 2,600 pages adding up to 70 million letters in all. Since there are about 3 billion nucleotide molecules in the human genome, it would take 43 volumes the size of this enormous dictionary simply to list the information that they carry. Let us call each of these volumes a Webster. Each Webster is three and a half inches thick so a human genome’s worth of information in the form of 43 Websters would fill a shelf 12 feet long . . . Suppose you took one of these Websters off the shelf and opened it at random, you would be confronted with a grey expanse of featureless type, with no spaces and no breaks into paragraphs. Examined more closely each line would look something like this:
TTTTTTTTTGAGAGATTTGCTGCTGCT
There would be, in each volume of this library of 43 books, over a million such lines of type all looking at first glance the same.
In reality, of course, each nucleotide molecule is minuscule compared to the capital letter (CGAT) used to represent it, so stringing together the 3 billion nucleotides of DNA results in a continuous strand only 25mm long. But these 25mm have to be packed into the nucleus of a cell about 0.005mm across, and in achieving this extraordinary feat
the DNA molecules pack over a hundred trillion times as much information by volume as the most sophisticated computerised information system that human intelligence has been able to devise.6
It is appropriate to stop here for a moment’s reflection. The single-celled conceptus, immediately after fertilisation, contains within its nucleus this trillion-times-miniaturised forty-three Webster volumes’ worth of genetic information, which over the next few months will replicate itself billions of times. Somehow the genes ‘know’ how to instruct the individual cells, first, to form the basic structure of the foetus with a back and front, head and limbs, and then to instruct the cells to fulfil the specialised functions of a nerve or a muscle or a liver cell, and then to instruct the specialised cells to grow through childhood and adolescence to adulthood and, in this process, to link up and interact with each other to form the functioning organs of the brain, the heart and the liver. This extraordinary potential of the biological information locked within the nucleus of each cell can best be conceived of as the mirror image of the infinite size and grandeur of the Universe.
It is little wonder then that in 1970 most molecular biologists, having worked out in outline the mechanism of the action of the genes as reflected in ‘DNA makes RNA makes protein’, believed they had reached the limits of what they could achieve. There was simply no way of locating within the vast impenetrable haystack of genetic information the individual straws of nucleotide sequences that made up the separate genes. ‘The time of the great elucidation has come and gone,’ wrote Nobel Prize winner Sir MacFarlane Burnet in 1969, as ‘the great objective’ of understanding how the genes work had been completed and ‘no one can discover that again’.7 Or, in the words of another molecular biologist, ‘at the dawn of the 1970s [only] a handful of cranks in the world thought it was not yet ti
me to wind up fundamental research on DNA. Nobody listened to them or took them seriously.’8 And yet, amazingly, ‘the handful of cranks’ were to be vindicated as over the next ten years four technical innovations cracked the apparently impenetrable complexity of the genes wide open.
Cutting the text: The first task was to try to isolate the individual straws of nucleotide sequences within the haystack of the genome to permit them to be scrutinised in greater detail.
Viruses, as the smallest of all organisms, do not have sufficient space within their cells to make the proteins necessary for their own survival and replication, so they infect organisms larger than themselves such as bacteria (or humans), and ‘borrow’ their protein-making machinery. Once inside the cell, they incorporate their own genes into those of the bacterium, so it starts producing the proteins necessary for their (the viruses’) survival. Anthropomorphically speaking, the bacteria resent being hijacked in this way and in retaliation produce a series of enzymes that immobilise the virus by chopping its genes up into little useless fragments. The first of these ‘restriction enzymes’, as they are called – or, in popular terminology, ‘DNA text-cutters’ – was discovered in 1968. A further 150 were identified over the following decade. Thus the addition of a combination of these text-cutters to human DNA cuts the three-billion-long string of nucleotides up into a series of more manageable sequences or, to put it another way, they make it possible to tear pages out of the forty-three volumes of Webster’s dictionary.9
Photocopying: But these single fragments (or pages) by themselves are still just an incomprehensible string of nucleotides – CGAT etc. etc. etc. ad, virtually, infinitum – so some means had to be found of, as it were, photocopying them hundreds of times, so that many different scientists can endeavour to work out what they mean. This brings us to the second technique, which exploits another important aspect of bacterial life.
Bacteria are asexual creatures and reproduce themselves by the simple expedient of dividing in two. They can, however, still swap genetic information between each other, thanks to a small circular string of DNA (or plasmid), quite distinct from the DNA of its own genes, which can be transferred like pass-the-parcel from one bacterium to another. In this way bacteria can ‘pass around’ the genes for resistance to antibiotics, which explains why they can all suddenly become resistant to, say, penicillin. If it were possible to get hold of a plasmid, make an incision in the circle of DNA so that it opens out into a string, insert a fragment of human DNA (obtained by the use of text-cutter enzymes), ‘reseal’ the plasmid and reinsert it back into the bacterium, then, every time it divides, so would the plasmid. After several divisions it would end up with large numbers of photocopied versions of the human DNA fragment. This was first achieved in 1973 and a couple of years later an industrious Harvard scientist, Thomas Maniatis, had completed a ‘library’ of DNA sequences covering the whole of the human genome.10
Finding the gene: It is all very well chopping up human DNA into little bits and ‘photocopying’ them, but what one really wants to know is what those bits mean and particularly whether they contain the sequence of nucleotides that make up a gene that codes for a protein. This was the really intractable problem to which the molecular biologists prior to 1970 believed there could be no answer. But they were wrong. In 1970 two Americans, Howard Temin and David Baltimore, discovered quite independently yet another very special enzyme, this time made by a certain type of virus. As this is the really crucial moment, it requires some elaboration.11
Consider the hormone insulin, made by the pancreas, which controls the level of sugar in the blood and whose deficiency results in diabetes. The sequence of nucleotides or the section of DNA coding for insulin (the insulin gene) within the nucleus of these pancreas cells will be generating a lot of messenger RNA, which then moves from the nucleus out into the main part of the cell, or cytoplasm, to be picked up by the protein factory (ribosome), whose reading of the ‘triplet code’ will ensure the correct arrangement of the amino acids that make up the insulin protein. This is all in line with the central dogma of genetics: ‘DNA makes RNA makes protein’. Doctors Temin and Baltimore’s momentous discovery was that an enzyme produced by a certain type of virus reverses this process, converting the RNA back into DNA (it ‘reverses the transcription’, hence the enzyme’s name ‘reverse transcriptase’). Theoretically, then, if the RNA coding for the insulin protein could be isolated from the pancreas cell, the addition of ‘reverse transcriptase’ would turn it back into the gene from which it originated, so the strand of hay of the insulin gene can be plucked out of the haystack of the human genome. What a coup!
So is that all there is to it – extract the RNA for a protein from the cell, add reverse transcriptase and you end up with the gene? Not quite. There had to be vast amounts of the relevant RNA in the cell for the process to work, and there were really only two situations in which this applied. First, there is a benign tumour of the pancreas known as an insulinoma, producing vast quantities of insulin and whose cells therefore contain abundant insulin RNA, to which the reverse transcriptase could be added to convert it back into the original insulin gene. The second is the red blood cell which, for important reasons relating to its function, contains masses of RNA coding for the haemoglobin protein, which carries oxygen to the tissues. Here, adding the reverse transcriptase converts the RNA in the blood cells back into the haemoglobin gene. The insulin and the haemoglobin genes were thus the first to be identified – whose significance, it is easy to appreciate, was profoundly important.12
Deciphering the gene: There is one final technical development to complete the quartet that underpinned The New Genetics. In 1977, again almost simultaneously, Frederick Sanger in Cambridge, England, and Walter Gilbert of Harvard University described two quite different methods of working out the precise sequence of nucleotides in any strand of DNA. So now it was possible not just to find the insulin gene but to know the precise sequence of the nucleotides of which it was made up.13,14
Thus within the ten years of the 1970s, molecular biologists had moved from a situation where the details of DNA were completely unknown, locked away in the trillion-times-miniaturised forty-three Webster volumes’ worth of information, to knowledge of the precise nature of certain genes. It is necessary to acknowledge that this potted description cannot begin to convey the true complexity of the intellectual problems involved and the scale of achievement in their resolution. By 1980 all that was required was a name, something that would encompass the potential of these techniques. In an editorial in the American Journal of Human Genetics in 1980 the editor David Comings observed: ‘Since the degree of departure from our previous approaches and the potential of these procedures are so great, one will not be guilty of hyperbole in calling it “The New Genetics”.’ ‘The New Genetics’ it became.15
Now imagine, for a moment, the situation in 1980. Sir Colin Dollery has just written the epitaph for the Age of Optimism, Nature is bemoaning the Dearth of New Drugs, and the clinical scientist is becoming an Endangered Species. Then suddenly and quite unexpectedly, like the mounted cavalry, The New Genetics arrives just in time to rescue medicine from this pessimism and despondency. It restores medicine’s faith in its future, placing it back on the rails of the relentless upward curve of knowledge that had started back in 1945. It bolsters the public perception of the intellectual status of the profession that, besides everything else, can understand the arcane mysteries of the genes and can pull, like rabbits out of a hat, the gene for this and the gene for that. And most importantly of all The New Genetics restored medicine’s status as an intellectual discipline. This was real science, of the sort that earned people Nobel Prizes and made genuinely new and important discoveries. There was more than enough to be getting on with, forty-three Webster-sized volumes of information whose meaning was just waiting to be clarified. The New Genetics was ‘the new dawn’ with the potential to have ‘the most significant effect on health since the microbiological revolution of
the nineteenth century’.
There were only two unnoticed flies in the ointment. The first, already alluded to, is that genes are, for obvious evolutionary reasons, not a particularly important cause of disease in humans, so the medical applications of this new knowledge was likely to be limited. Second, despite the elucidating power of the techniques of The New Genetics, the genes are so obviously very complex as to defy any profound understanding of how they work. Perhaps Isaac Newton’s famous observation more adequately expresses what might be hoped for: ‘I do not know what I may appear to the world, but to myself I seem to have been only like a boy playing on the seashore, diverting myself now and then, finding a smoother pebble than ordinary, whilst the great ocean of truth lay all undiscovered before me.’
The Rise and Fall of Modern Medicine Page 29
