“I don’t think it’s that straight forward,” Ryan said. “At this point all we can say is that the stone might turn a leper into a vampire. We don’t know what it might do to someone else.”
“You really think there’s a connection with her disease?” Siri asked.
“I’m certain of it,” Ryan replied. “Half of this microbe’s DNA just sits and does nothing. It’s a degraded genome with large regions of pseudo genes, but look at this . . . .” Ryan entered some keystrokes and a window appeared on his display with lines of base sequences. “You see this first line?”
Siri looked at the display.
“This sequence . . .” Ryan moved his pen along a string of characters on the screen:
. . . ACGGTTGCGGTATCCGTGACGGGAACTA . . .
“. . . is from a region of Calida’s DNA. It and several others like it, shows up in all her samples. The irony is,” and Ryan shrugged, “it’s the first gene sequence I obtained from her skin.”
Siri smiled at him but didn’t say anything.
“Yeah, it’s funny to me too,” he said. “They are extremely small sequences, less than a hundred bases in length, but they are an exact match for a gene sequence that is part of Mycobacterium leprae’s genome.”
“Can you identify a specific gene yet?” Siri asked.
Ryan nodded. “That sequence is from a leprae gene that codes for a secreted antigen. And Calida has these sequences incorporated into her own DNA.”
“So this stone, this element, somehow fused her human DNA and leprae’s together?”
“Fused, mutated, politely persuaded . . . call it what you want, but given this data, and the fact that leprae is an example of reductive evolution, we have to wonder what would be the result if a normal, healthy person came in contact with this stone. It might do something different, perhaps even worse.”
“This, this scares me more than she does,” Siri said.
“I’m with you—and you know those prions she secretes from her skin that bind to areas of our brains controlling suggestion?” Ryan watched Siri nod. “Those prions contain the protein compliment to the leprae sequence I just showed you. Those cylinders serve multiple functions. They are the prions and probably also have something to do with her ability to change appearance and who knows what else.”
“How long do you think her abilities took to develop once she contacted the stone?” Siri asked. “And why would she even evolve the ability to control, or read people’s thoughts?”
“I think you have it,” Ryan replied. “It evolved. Why did bats evolve the ability to echo-locate?”
“Probably to find prey—food.”
“Same thing must be at work with her. She can infect multiple people at the same time and pick each one off whenever she needs to feed.” Ryan sighed. “The Vampirenium somehow mutated her genome with leprae’s and over time she evolved this predatory mechanism so she can acquire her favorite food as efficiently as possible.”
“Us.”
Ryan nodded. “Leprae is an obligate parasite totally dependent on an intracellular existence. And Calida is also an obligate, but in a different way.”
“Without us she can’t survive.”
“Right, but she only uses us as food . . . what if someone wanted to become like her but had a specific agenda?”
“Which is why this stone needs to stay lost.”
“Permanently.”
“I don’t think there’s any imminent danger of it being found.”
“Probably not. I just hope there aren’t more of these stones sitting around inside caves waiting to be discovered.”
Calida slept through the entire return flight from Los Angeles. They had placed her in a large metal canister that was used to carry short range missiles by the air force. The inside had been stuffed with heavy foam along with an air mattress to accommodate her. Heavy duty holding straps made sure she didn’t get bounced around.
The flight left LAX at 11:00 AM and touched down at
Andrews at 9:20 PM. Calida came out of her day-sleep during the truck ride from the airbase to the facility. She didn’t panic when she woke up inside the pitch black canister. Claustrophobia in a dark place was one demon that she had cast out ages ago.
The truck made a stop and they started moving again. After a few minutes of slow travel it again stopped, went up a small incline, and came to a final stop as Calida heard the engine shut off. She heard footsteps outside her confines and then the loud snaps of metal latches. The canister opened up and two male agents reached towards her and undid the straps.
“Get out,” one of them said.
Calida sat up and touched her face. Not quite done healing, but almost, she decided. She looked out the rear of the truck. The driver had pulled inside the same receiving bay from where she left three nights ago.
“C’mon, get going,” the same agent instructed.
“What’s the rush?” Calida asked, and she took an immediate dislike to the tone of his voice.
“We have orders to get you back to your room ASAP. Now either you get out or we’ll pull you out.”
“You think the two of you can force me?”
The agent reached inside the canister and grabbed her arm and said, “Have it your way.”
Calida took hold of his wrist with her free hand and twisted. “Don’t ever touch me again, do you understand?”
The agent writhed around trying to free his arm, but Calida held onto him as if he was a doll.
“You’re breaking it,” he forced out, the tone of his voice now an octave higher.
Pleased with herself, Calida released his wrist the instant before the bones would snap. “You’re welcome,” is all she said and stepped from the canister. She walked out of the truck leaving the agent doubled over holding his wrist.
The second agent gave her an uncomfortable look. “Listen, Miss,” the other agent said. “He learned his lesson, and I don’t need you to repeat it, okay?”
“Okay with me,” Calida replied.
The agent relaxed and took a breath. “How about you just walk with me and I’ll take you back to your room.”
“Room? You’re joking, right? It’s a prison.”
“The Director wants to debrief you and he’s waiting. So please?”
“Tell your friend to be polite next time,” Calida said. “It would have saved him from the lesson.” Calida looked back inside the truck at the agent who was now leaning up against the canister wriggling his fingers. “But if he’s as stupid as I think, next time I’ll do more than just break it. I’ll bite his hand off.” Calida was amused with herself, she couldn’t recall ever doing that to someone.
The agent nodded and motioned for her to follow him. He led her to a door at the rear of the docking bays and they walked out into the night. Two other agents who had been waiting outside joined them and escorted her back to the medical clinic.
She watched the steel door slide open and when they arrived at the air lock, the guard who had been polite said to her, “You go inside by yourself. We’ll just stay out here and make sure, uh, make sure . . . look, you understand?”
“No problem sweetie,” Calida responded. “I can sense everyone has strong feelings for me.” She stepped inside the air-lock and turned her back on the men.
A single guard waited for her when she emerged.
“Hello, William,” she said.
“Uh, okay, just let me know if you need anything.”
“I don’t know, do you want to feed me tonight?” she half-teased and continued down to the observation platform.
Halfway down Calida stopped. She could sense that the Director was inside waiting for her as the agent had said. Calida took several more steps and looked through the glass at the Director sitting in a chair a discrete distance away from the doorway with his back to her. Everything about the man was always measured so she stopped hesitating, walked right in, and sat down on a bed that had replaced the cot.
“You shouldn’t have.”r />
“And you disappoint me,” the Director said, lighting his pipe. “You nearly made a mess of things.”
“Did I?” Calida grinned. “But I had nothing to do with the boat. You sent me into a trap you little bastard.”
The Director let out a long puff of smoke. “Possibly, but it is a dangerous business we’re in.”
“I’m lucky everything grows back.”
“Ooh yes, my dear, I’ve seen the pictures of your face . . . gruesome damage to be sure.”
Calida didn’t respond and just looked at him with unwavering hatred.
The Director leaned forward on his cane. “Leaving the man at the motel was quite clever, I must admit. You forced the agency to deal with it . . . I would say you did this purposely.”
“I’m glad you appreciated it.”
“Yes.”
“Why are you here?”
“Why indeed,” he replied. “Now that our pleasantries are over you can tell me what you’ve learned.”
Calida bit into her lower lip and outwardly sighed. “Your Pashtun friend, Husaam, is right now returning to Kandahar. You have all the information you need, so again, what are you doing here?”
The Director took his pipe out of his mouth and held it by the bowl. Calida noticed the pipe shaking from a hand tremor. “I need you to explain why you were unable to detect the presence of the hidden explosive,” he replied. “Tell me what happened.”
“I sensed there was a danger . . . I just didn’t have enough time.”
“That certainly isn’t good enough, and it won’t be good enough.”
“For what?”
“My dear Calida,” the Director began, condescendingly, “in one week you are going to be sent to a place where women have no practical rights and tribal law governs the land. It is a country of religious obsessions, rampant distrust, murders, rape, assassinations—retributions are merely standards of living.”
“I’ve been to this region before,” Calida said, her apathy clear. “I’ve spent long years there and watched the beginning of their paranoia spread. Don’t waste your time trying to lecture me about things you have only an ignorant grasp of.”
“Yes, yes, I do forget your age at times.”
Calida tensed. She placed her feet on the concrete and put her hands out to her sides gripping the edge of the mattress. “You knew all along about the explosives.”
“What does it matter?”
“This was another one of your tests . . . is that it? You made me take Christopher . . . and nearly got me killed just to see if I would be able to read the minds of those two fanatics.”
“Did I not inform you that there would be training involved with your employment here?” the Director replied, with mock indignation.
“What you say and what is reality are two separate things,” Calida responded.
“Aren’t you clever,” he replied. “Now listen and learn. The agency had an operative placed within their group that was able to inform us of their plans. He was a valuable asset, a native Pashto educated in the west. His business associates wanted to eliminate him because his drug gang would not allow them to sell to other rival gangs. It all comes down to money in the end. It is the way of this world, yes?”
“Not the way of mine,” Calida said. “And if I had discovered the explosive, what did you expect me to do about it?”
“Simply to carry out your instructions,” he replied. “You actually did quite well, you know. You easily made contact with our now deceased heroin dealer and retrieved the information we needed to place you in Pakistan at the right time and place.” The Director paused and tapped out his burnt pipe ashes on the floor. “And the west coast authorities are under the opinion that a gang squabble got out of control. So your tracks were neatly covered, my dear. It all worked out as I had expected.”
Calida looked at him and shook her head. “Your mind is sick,” she said, disgustedly. “And there’s only one cure for you.”
“I am in no need of any cure from you and let’s not have a repeat of your vampire bravado, Agent Villena,” the Director said, tapping his cane on the concrete.
Calida relaxed and sighed. “So now I’m trapped in here until you need to have someone killed again.”
“Who said anything about you being trapped? You may go take a stroll if you wish . . . but don’t forget that we know where you are at all times. If you leave a quarter mile circle, which has this building at its center, you’ll only receive a brief ten second warning to return before . . . the end.”
“And I’ll always have escorts?”
“Yes, yes, you’ll always be under close supervision, of course,” the Director replied. “You were brought here because, well, it really is the safest place for you during the day and it happens to be where your bottle is setup.” The Director pointed his cane at the feeding machine.
“How do I know there won’t be another one of your tests waiting for me the second I step outside?”
“I assure you that nothing is planned for you,” the Director said. “But why don’t you just read my mind and find out for yourself.”
“I’d rather you explode my head,” Calida said.
“I can, at any moment.” The Director smiled. “It is time to discuss your next assignment.”
“No, I’ve talked enough to you.” Calida stood up and walked over to her dresser where several towels had been neatly folded and stacked. “Get out. I’ve showered for you once already.”
The Director stood up and came closer to Calida who reflexively stepped backward until she was against the rear wall of her cell. She felt the beginning tingle of the device in her head.
“I will allow you this brief respite, my dear,” the Director said. “But tomorrow you and I will be having a long talk. So please do whatever you must to prepare yourself. Shower, brush your hair, take a mid-night walk, or drink blood. I shall, of course, expect your complete cooperation and attention.” The Director came to a stop at the outside range of the implant’s warning zone. “I don’t have time to show you anymore patience. The powers that be grow restless.” And he turned away from her and walked out of her cell.
Ryan ordered Professor Balken out of the lab and back to his quarters for some rest. The old scientist had been in the lab for twenty straight hours when Ryan discovered him asleep at the CRAIC. Ryan had come to a realization that the man was brilliant, even at his advanced age, but what Ryan didn’t need was to baby-sit the man and make sure he regularly ate and slept.
By 9:00 PM, Ryan felt tired. Staring at computer displays and performing the tedium of genetic research was not only a strain on his eyes, but his mind and body as well. He got up from his workstation and did the nightly check on the HeliScopes. The control console indicated that both systems were running within nominal specifications, although system two showed a slight fluctuation in one of its detectors. Ryan brought up the detector’s interface and decided the slight increase in noise from the baseline wasn’t anything that needed immediate attention.
Finished with the maintenance check he noted the equipment log and raised his hands above his head. His back was stiff from being hunched over all day. He turned away from the control console and decided to go back to his quarters. He needed rest so he could get a fresh start tomorrow morning. But when he looked toward the front of the laboratory Ryan did a double take. Calida stood by the entrance, watching him.
“So this is where you spend your time?” she asked.
Ryan fought a grave internal conflict. One part of his mind screamed for him to run, another merely reassured him that he had lived a decent life.
“You have nothing to say to me?” Calida asked. “Or would you feel better if I was chained to the floor?”
“Just tell me why you’re here,” Ryan finally got out.
Calida began to walk around the lab. “Is all of this for me?”
Ryan swallowed. “Most of it.”
“You can relax, Ryan,” Calida said. “I’m not go
ing to hurt you.”
“Why should I believe you? Christopher was left alone with you and now he's dead.”
Calida let out a sigh and said, “I’ve been responsible for many deaths. But his wasn’t my fault.”
“I’ve seen the video.”
“Then it must be true.”
“Why did you do it?
A look of frustration appeared on Calida’s face. “I didn’t want to harm him. I didn’t have a choice.”
“You’re not making any sense,” Ryan said.
“Nothing about it does.”
“So where did you go?”
“To the west coast.”
“Why?”
“For . . . for some fun and dancing.”
“And who did you kill?”
“Does that matter?”
“Yeah, it does.”
Calida strolled between two opposing lab benches, allowing the fingers of her right hand to glide along one of the long grey tops.
“So you can just go anywhere you please now?” Ryan asked, and he fought the urge to move away as Calida came to the end of the first set of benches and turned onto his aisle.
“I can go anywhere, within reason,” she replied. “And I have to behave. Is this a problem for you?” Calida walked to where Ryan stood and jumped backward onto the bench across from the one he leaned against.
Ryan was now less than eight feet from Calida who slowly swung her legs as she sat on the edge of the bench. Only air separated them.
“Why are you here?” he asked.
“That little lunatic said I could take a stroll if I wanted. So I did.”
Ryan couldn’t stop staring at Calida. Her vibrant, dark brown hair shimmered with a deep red when it moved. Her skin glowed with the olive complexion of the Mediterranean. Her eyes were that same amazing blue that he understood to be her real color. She wore a pair of low-cut jeans, black leather sandals, and a simple green, short-sleeved blouse.
“Don’t put too much trust in that man,” Ryan said and he looked away from her. “He’s even more dangerous than—than you.”
“So I’ve discovered.”
Ryan took a deep breath. “Look, when you talk I can see your fangs.”
American Blood: A Vampire's Story Page 20