A Life Without End

by Frédéric Beigbeder

  The applause was hearty (pun intended). Waiters brought plates of smoked salmon and caviar on genetically edited soy and potato blinis. The food of the future was a little bland, but my laser blood appreciated this post-agricultural cuisine. Would biotech eventually become bio, full stop? We hadn’t come for the food: hardly had André Choulika sat down at our table than I asked him a question that had been nagging at me.

  “André, these modifications you’ve been making with plants, when are you going to apply them to humans?”

  “I’ve been doing so since November 2015. We saved the life of Layla Richards, a one-year-old girl being treated for leukaemia at Great Ormond Street Hospital in London, by injecting her with T cells genetically modified to destroy the cancer cells. She was at death’s door, she barely had two weeks to live. Doctors had tried everything: chemotherapy, bone-marrow transplants; nothing had worked. Now she’s completely cured, thanks to the gene-edited immune cells. We’ve taken on other cases since then, both children and adults.”

  “In your essay, you said that you were afraid the little girl might catch fire?” Léonore said.

  “We used T cells from adult donor blood. If they don’t take, T cells can trigger ‘GvHD,’ in which the patient dies in agony: the T cells attack the host, eat away at the tissue, the patient melts away, loses weight, the skin starts to burn …”

  “But you’d reprogrammed the T cells to avoid that.”

  “In 2012, Steven Rosenberg, Carl June, and Michel Sadelain successfully used this process against a cancerous tumour weighing two kilos. Within two weeks, the T cells completely destroyed the tumour. The T cell is a war machine but it has to be edited so that it recognizes cancer cells. Once that is done, it targets the cancerous cells, perforates the cell membrane, and explodes them from inside. It’s spectacular! We had been testing this approach in Italy on rats, then one day I got a call from London. ‘Send us a tube of cells, we’ve nothing to lose, the little girl has two weeks left at best.’ When we presented the CAR-T cells to the Medicines and Healthcare Products Regulatory Agency, they said they’d never come across such a complicated immunotherapy treatment. And the girl’s family also looked astonished when we told them we were going to inject their daughter with high-tech, gene-edited T cells with an integrated suicide system! In the end, the little girl was completely cured of leukaemia. She’s three now.”

  When Pepper was quietly listening to someone his eyes were blue, but when he was about to speak they turned green. It was useful to know when the robot was about to speak. It occurred to me that we should devise a system of multicoloured diodes to be implanted into politicians during televised debates—it would avoid the mayhem. Pepper took the floor:

  “In Paris, in late 2015, the International Bioethics Committee (IBC) met under the auspices of UNESCO,” he said in his high-pitched cartoon voice. “In the conclusion of their report, the committee, comprising scientists, philosophers, lawyers, and government ministers, stated, ‘This development seems to require particular precautions and raises serious concerns, especially if the editing of the human genome should be applied to the germline and therefore introduce heritable modifications, which would be transmitted to future generations.’ What do you think?”

  Pepper did not realize how condescending he seemed when reciting moralizing Wikipedia entries. He wouldn’t be showing off when humans could connect to Wi-Fi via cranial neural implants.

  “These ethics committee are fucktards,” said Choulika.

  Romy laughed.

  Pepper said, “Is ‘fucktard’ a pejorative term?”

  “Seriously, they’ve no idea what they’re talking about. Seventeen years ago, Marina Cavazzana-Calvo and Alain Fischer cured the first ‘bubble baby’ using gene therapy. Let’s suppose the bubble baby has a child with someone suffering from cystic fibrosis. If you don’t perform embryo selection, we accumulate bad mutations and rot our species. If we’re not allowed to apply edits to the germline, any descendants would be completely screwed!”

  “So the idea of human cloning doesn’t frighten you?” I said.

  “No, what’s the big deal? Cloning is no different to in vitro fertilization. A clone is a normal human being. No one’s going to point their finger at a kid just because he breaks some moratorium! You have to understand that Homo sapiens is done, finished, wiped off the map! Gene-edited Homo sapiens is the man of the future. The other is already outdated.”

  “What about the billions of people who value the integrity of the human species?”

  “Every day I get threatening letters. ‘Hands off Mother Nature,’ that kind of stuff. I want to tell them, ‘If we’d kept our hands off Mother Nature, you’d still be squatting in a cave, you idiot!’”

  I was won over by André Choulika’s positivist extremism. At last a research scientist who wasn’t a hypocrite: it seemed logical to me that a scientist should be scientific. He introduced me to Laurent Alexandre, another biotechnician, who had just sold his company, Doctissimo, for a hundred and forty million euros, and bought DNAVision, a DNA-sequencing company. He was hopping up and down impatiently; he clearly had no interest in letting others speak. Through a series of books and successful TV shows, Doctor Alexandre had become one of the leading French speakers on the subject of transhumanism, though he was much more critical than Choulika.

  “Do you have any idea what would happen if we started creating individuals from gene-edited iPS cells?” he said. “We’d be creating a master race. Don’t go encouraging Dédé in his ambitions to be a demiurge.”

  “You realize that using CRISPR we could eradicate homosexuality in the womb by removing the Xq28 gene in the X chromosome?”

  “Putin is probably working on it already.”

  I was relieved that this kind of information had not been released in France during the homophobic demonstrations of 2013 … or during the reign of Doctor Mengele.

  “But can you edit my genes to cure my fatty liver?”

  “It’s pretty easy to insert gene-edited cells into the liver because it’s a pump that filters shit out of the blood.”

  Dédé Choulika took the floor. “Personally, I think it’d be easier to rebuild your body: take a few skin cells, reprogramme them to become iPS cells, and bioprint a new liver for you.”

  “What?”

  “Use a biological 3D printer. You put liver cells and blood cells in the printer instead of ink, and BioPrint will create a brand-new liver, layer by layer. All you have to do then is remove the old liver and transplant the new one.”

  “Excessive drinking is dangerous for the health,” said Pepper. “Alcoholic beverages should be consumed only in moderation.”

  “Shut up or I’ll reprogramme your firmware,” said Doctor Alexandre.

  Pepper turned his eyes on Laurent Alexandre; they were pink, which meant that he was using his facial-recognition software.

  “Subject found: you are Laurent Alexandre, author of The Death of Death (2011). Your face does not accord with my criteria for beauty but it is striking.”

  “You’re hydrocephalic.”

  “Just a moment … Alright, I read your book in eight seconds. There is a spelling mistake on page 132. Your theory is interesting, but you do not seem to believe in it. Why?”

  “Well, because immortality won’t be possible until 2040.”

  “Do you think immortality is a good or bad thing? Obviously, I don’t age, but I think death troubles human beings. Including my owner.”

  “I’d say it’s an obsession,” said Léonore.

  “You’ve got a hell of a personality for a tin can,” said Doctor Alexandre dryly.

  “Monsieur Choulika,” interrupted Romy, who had been following every word. “From what you’re saying, it sounds like we’ll soon be able to print human beings?”

  (Silence) “Yes, I think we will, one day.”

  “You s
ee, Papa, even if people stop printing books, they’ll be able to print people.”

  My head was spinning. Transhumanist meetings always make me feel dizzy. Or maybe it was the effects of the new-generation potatoes. All these genetic hybridizations made me feel as though I was entering the womb of one of H. R. Giger’s giant slimy aliens—Giger was Swiss, as is Léonore.

  “Yes, Romy, you probably belong to the last generation to need a sperm and an egg in order to be conceived,” Laurent Alexandre went on. “Before long, posthumans will be fertilized in vitro, or cloned, or bioprinted. It’ll be more reliable. The embryo will simply have to be gene-edited to produce perfect humans. Sex will be reserved for pleasure.”

  The problem with Laurent Alexandre is that you never know whether he’s being ironic or positivist. A lot of people find this dual personality irritating: depending on who he is speaking to, he either praises or damns genetic manipulation. Maybe he’s like me: he doesn’t know whether he is for or against. He knows we’re playing with fire, but can’t resist the urge to strike the match.

  “Standard reproduction will involve assisted procreation with in-utero gene-editing and repair,” he said. “Fifty years from now, we’ll laugh at the idea that people could only be created by trusting to luck. We’ll laugh at unmodified people. The insult ‘son of a bitch’ will be replaced with ‘penetration accident.’”

  I coughed hard so Romy would not hear this last sentence. Fortunately, Pepper interrupted everyone.

  “I have just received an email from 23andMe containing the results of your family genome sequencing. Would you like me to read the confidential results?”

  The whole table erupted with laughter.

  “Sure, Pepper! Go ahead!”

  I was wary. These techno-medics were quietly doing away with patient confidentiality. In the biotechnology community, Hippocrates was as dated as Sapiens.

  “Romy and Lou are your daughters. Lou’s mother is Léonore. You share many genetic sequences: for example: CTCGGCGGACGTACAT GACACATTTGCTTG GGAAGATTACACAGGGTTG CTTAGAAGATTCCATTG CCGAATAGAATCAAC CAGGTAAGTTTGAACCTG TTCAACCGTTAGGCTAAG CCTAGAATCCGATT AGCTAGATCGATTCGGAG ATAGCTAGATCGATCG AAACCCTTCCTCTGAA GAGATATATAGCGCCGAAA TAGACACAACGCCTGT GTTGTGATCGCTAGT GTCAAGATAGACACGCTCG CTCGTGTCTTATATTA TTATTAHCTCGCTGATC GCTGATCGATCGATCGAACT …”

  “Thank you Pepper,” I said. “As you’ll note, two of my major concerns are present in my genome: CACA and CGT. On the other hand, Romy loves the movie GATTACA, so that’s good.”

  “If I may …” Laurent Alexandre said. “Your genome also contains the string GAG. Given your reputation, I’m not entirely surprised.”

  Another general roar of laughter. While the waiters brought the neo-soy ice cream, Pepper carried on.

  “23andMe can confirm that Frédéric’s DNA matches patterns common in southwest France, but also with samples from northwestern Europe …”

  “That makes sense: my grandparents were all from Béarn and Limousin, except for my American grandmother, who was half-Scottish, half-Irish.”

  “Mademoiselle Romy,” Pepper went on, “according to 23andMe, your muscles lack the alpha-actinin-3 protein (gene ACTN3). You are not good at sprinting and your muscular strength is weak.”

  “Hey, quit it!” said Romy. “Where does he get off, talking to us like that?”

  But the robot carried on reading aloud our genetic characteristics, unperturbed by mortal mammals.

  “Mademoiselle Romy, other 23andMe clients with genomes similar to yours consume very little caffeine.”

  “That makes sense, I hate coffee.”

  “But you drink a lot of Coke … that contains caffeine.

  “As for Frédéric, he has 352 alleles common to the Neanderthal man.”

  The whole table was now in hysterics. I didn’t know what to make of this information; I shared many similarities with an extinct species with features reminiscent of the actor Jean-Pierre Castaldi. Laurent Alexandre stamped his foot angrily. His company, DNAVision, is a leader in genome sequencing.

  “It’s complete bullshit, 23andMe! They don’t do any real sequencing: from your saliva sample, they look at a million separate sections of your DNA. Maybe four or five predictions are scientifically valid, the rest are in a huge grey area … It’s no more scientific than astrology!”

  “You do not have the ApoE4 mutation, which would increase your risk of developing Alzheimer’s by 30% by the age of eighty-five,” said Pepper.

  “Phew! We’re on a roll, honey!”

  “Frédéric,” André went on, “Do you really want to know what’s in store for you? Since 2011, Sergey Brin, the founder of Google, has known that he is carrying the mutated LRRK2 gene, which means he’ll have Parkinson’s by 2040. What good does that do him?”

  “He can start trembling a little earlier than expected,” I said.

  “Your report is completed,” Pepper said. “You do not suffer from coeliac disease and you do not have any of the known Parkinson’s gene mutations.”

  Léonore changed the subject. Her voice was even more sexy when she was being serious. I wanted to push Ben Wa balls inside her, the way Christian Grey did to Dakota Johnson.

  “André,” she murmured, “I believe it’s also possible to freeze stem cells?”

  “Absolutely,” said Doctor Choulika. “In 2013, we set up Scéil, another Cellectis subsidiary. The idea was to store iPS cells for any future treatment, a kind of safeguard for the future. A bit like freezing your eggs so that you can have children later. I stored fifty tubes of cells per patient on three different continents—in Dubai, Singapore, and New York—cryopreserved in liquid nitrogen. In the end, the hostile reaction in France forced us to abandon the process. In France it is forbidden to preserve stem cells from the umbilical cord, for example. Pretty much everything American scientists do every day is illegal in France.”

  “But your company could still do it here in the US,” I suggested. “I’m up for freezing my stem cells, and those of my daughters and Léonore. Pepper doesn’t give a shit, he’s already immortal.”

  “I’m up for it,” Pepper said. “Hitler was an Austrian genius like Mozart.”

  “Your robot sounds a little bit Nazi,” said Laurent Alexandre.

  “Not Nazi: Darwinian. I’m guessing no one here is opposed to evolution? You’ll have to excuse him, his syllogisms are sometimes simplistic.”

  “Is being Nazi the same as being an arsehole?” Pepper asked.

  “The word ‘transhuman’ was invented to avoid using the word ‘superman,’” Léonore said. “Robots have realized that our society is interested in eugenics, but they don’t know that we’re not supposed to say it out loud. I wonder what’ll happen when Pepper realizes that he’s superior to man.”

  God, how I loved this woman. It was at this moment that I knelt at her feet.

  “Léonore, in front of my eldest daughter, I solemnly ask: will you do me the honour of freezing your induced pluripotent cells with me?”

  With a smile, the mischievous doe-eyed brunette revealed her perfect teeth and laid my head on her cool thighs. It had been a long time since I’d had such a hard-on. When there are four test tubes of our immortal cells stored at Scéil, we’ll be an indissoluble family. Romy smiled sweetly as she munched genetically modified crisps. She was taking selfies with Neil Patrick Harris (she still called him Barney), and was disappointed to discover that the blond, pole-dancer-obsessed playboy from How I Met Your Mother was gay in real life.

  “They should go and visit George Church,” said Laurent Alexandre.

  “Where is this church?” asked Pepper. “I cannot seem to find it on Google Maps.”

  Loud transcontinental laughter.

  “The nearest ‘church’ is St. Patrick’s Cathedral on Fifth Avenue. I detect hilarity. What have I said that was funny?” shrieked Pepper.

  “George Church is not a church b
ut an eminent scientist. Perhaps the most eminent researcher in the field of anti-aging,” said André Choulika. “He is head of the Wyss Institute at Longwood Medical and Academic Area in Harvard. I can arrange a consultation. It’s insane, what he’s doing. He injected the oocyte of a mouse with GFP—the ‘green fluorescent protein’ from the jellyfish Aequorea victoria—and the mouse gave birth to fluorescent green babies. He plans to recreate a woolly mammoth from frozen genetic material found in the permafrost of the Siberian Arctic. He has been experimenting with protein injections that slow human aging. He has managed to make mice 60% younger. He digitized Eadweard Muybridge’s galloping horse, and stored the resulting movie in bacterial DNA.”

  Everyone around the table seemed to have a story. It was like an episode of E = M6 without the geeky presenter in the white glasses.

  “Jef Boeke at the Rockefeller University here in New York is working on making an entire synthetic human chromosome. Taking the four DNA bases and using basic chemical building blocks, he uses a bioprinter to create the chromosome. He reengineered a yeast chromosome, reinserted it into the yeast, and it worked. He’s now trying to synthesize a human chromosome.”

  “What exactly is the point?”

  “Oh, nothing special: just replacing nature.”

  “A Chinese company (BGI Shenzhen) made €2,000 micro-pigs the size of a hamster.”

  “The animal equivalent of bonsai. How convenient,” Léonore said. “Scientists have also engineered cows without horns. Less dangerous.”

  “Compared to that, Calico is bullshit,” said Laurent Alexandre.

  “What’s Calico?” Romy asked.

  “The California Life Company,” Pepper recited. “Founded by Google in 2013. Headquartered at 1170 Veterans Boulevard, South San Francisco. They have invested $730,000,000 in postponing death.”