The Swarm: A Novel

by Frank Schätzing

  Johanson opened his eyes and found himself lying amid rumpled sheets in a strange bed. Other beds were lined up around him, all empty. It was a big room, full of equipment, with no windows and a sterile appearance. A sickbay.

  What the hell was he doing here?

  His head lifted and fell back on to the pillows. His eyes closed of their own accord. Anything would be better than the hammering in his head. He was even feeling nauseous.

  ‘Oh-nine hundred hours.’

  Johanson sat up. He was still in the same room. He felt significantly better, though. The queasiness was gone, and his head no longer felt as though it were being crushed in a vice. The pain had subsided to a tolerable ache.

  He still didn’t know what he was doing there.

  He looked down at himself. Shirt, trousers, socks - the clothes he’d been wearing last night. His down jacket and sweater lay on the next bed, with his shoes arranged neatly on the floor.

  He swung his legs over the side of the bed.

  A door opened and Sid Angeli, the head of the medical unit, came in. He was a small Italian with a thin circle of hair and deep creases round his mouth. He had the most tedious job on the ship since no one was ever ill. That seemed to have changed. ‘How are you feeling?’ Angeli cocked his head. ‘Everything OK?’

  ‘I’m not sure.’ Johanson touched the back of his head and flinched.

  ‘It’ll be sore for a while,’ said Angeli. ‘Don’t worry, though - it could have been worse.’

  ‘What happened?’

  ‘You can’t remember?’

  Johanson thought hard. ‘I could use a few aspirin.’

  ‘But you don’t know what happened?’

  ‘No idea.’

  Angeli came closer. ‘Uh-huh. Well, you were found on the hangar deck in the middle of the night. You must have slipped. Thank God the ship is under video surveillance or you’d still be there. You probably hit your head on one of the struts.’

  ‘On the hangar deck?’

  ‘Yes. Don’t you remember?’

  Of course. He’d been on the hangar deck with Oliviera. Then a second time, by himself. He could remember going back there, but he couldn’t think why. And he had no recollection of what had happened next.

  ‘It could have been really nasty,’ said Angeli. ‘You, er, hadn’t been drinking, had you? I only ask because there was an empty bottle down there. Sue Oliviera said the two of you had cracked open some wine.’ Angeli splayed his fingers. ‘Don’t get me wrong, Dottore, it’s not a problem, but helicopter carriers are dangerous places. Wet and dark. It’s easy to slip over or fall into the sea. It’s better not to wander around on your own if you’ve, er…’

  ‘…had a glass or two,’ Johanson finished for him. He got up, and the blood rushed to his head. Angeli was there in an instant, holding his elbow. ‘I’m OK, thank you.’ Johanson shook him off. ‘Where am I anyway?’

  ‘In the infirmary. Can you manage?’

  ‘Provided you give me those aspirin.’

  Angeli walked over to a shiny white cabinet and took out a packet of painkillers.

  ‘Here you go. You hit your head, that’s all. You’ll soon feel fine.’

  ‘OK. Thanks.’

  ‘Are you sure you’re all right?’

  ‘Yes.’

  ‘And you can’t remember anything?’

  ‘Like I said, no.’

  ‘Va bene.’ Angeli gave a wide smile. ‘Take things gently today, Dottore, and if you experience any problems, don’t hesitate to come back.’

  Flag Command Center

  ‘Hypervariable sections? What the hell’s that supposed to mean?’

  Vanderbilt was struggling to keep up. Oliviera realised that she was in danger of losing her audience. Peak looked bewildered too. Li’s expression was as inscrutable as ever, although it seemed likely that her knowledge of genetics was under severe strain.

  Johanson sat among them like a ghostly presence. He’d turned up late, as had Rubin, who’d come in mumbling apologies for his absence. But, unlike Rubin, Johanson seemed genuinely ill. His gaze was unsteady and he kept glancing around, as though he needed to reassure himself every few minutes that he wasn’t hallucinating and that the people around him were real. Oliviera made a mental note to have a word with him.

  ‘It might be easier if we started by talking about normal human cells,’ she said. ‘You can think of our cells as bags of information wrapped in membranes. Inside each cell is a nucleus, and inside the nucleus are the chromosomes - home to our genes. The genome is the complete set of genetic information, the full sequence of DNA, the famous double helix. In simple terms, it’s our design plan. The more complex an organism, the more sophisticated the plan. The results of a DNA test can be used to find someone’s killer or prove that people are biologically related, but by and large we all share the same blueprint: feet, legs, torso, arms, hands and so on. In other words, an individual’s DNA can tell you two things: first, that they’re a person; and second, who they are.’ She saw interest in their faces. It had been a good idea to start with some basic genetics.

  ‘Of course, two individual humans will have less in common than two single-cell organisms of the same species. Statistically speaking, there’ll be three million small differences between my DNA and the DNA of any other person in this room. Human beings are differentiated from one another by roughly one difference per twelve hundred base pairs. What’s more, if you were to take two different cells from the same individual, you’d still find small variations - biochemical discrepancies in the DNA, caused by mutations. Consequently, the results will be different if you analyse a cell from my left hand and one from my liver. But the DNA will tell you clearly that those cells belong to Sue Oliviera.’ She paused. ‘Single-cell organisms are a slightly different story. The cell is the entire organism. So there’s only one genome, and since single-cell organisms reproduce asexually, there are no parent cells to pass on their chromosomes. It works by cell division. The organism duplicates itself and all its genetic information.’

  ‘So, as far as single-cell organisms are concerned, if you know one DNA sequence, you know them all,’ said Peak, choosing his words carefully.

  ‘Yes.’ Oliviera rewarded him with a smile. ‘That’s what you’d expect. A population of single-cell organisms should have largely identical genomes. Apart from a minimal rate of mutation, their DNA should be the same.’

  She saw Rubin shifting impatiently on his chair, desperate to speak. Usually he would have tried to butt in by now and take the lead. Poor Mick, thought Oliviera, in satisfaction. What a shame you were confined to your bed last night with a migraine. For once there’s something you don’t know.

  ‘But that’s exactly the problem,’ she continued. ‘At first glance, the cells in the jelly appear identical. They’re amoebas - not even a particularly exotic variety, just ordinary deep-sea amoebas. But it would take at least two years and a whole army of computers to decode their DNA in full, so we settled for analysing a diagnostic section. We isolated the DNA and amplified key regions for sequencing. We call them amplicons. Each amplicon contains a sequence of base pairs - the language of genetics. Now, when we compare amplicons from DNA belonging to different individual organisms, we see something interesting. Amplicons of different organisms belonging to the same population should look something like this.’

  She held up a print-out that she’d blown-up for the meeting:

  A1: AATGCCAATTCCATAGGATTAAATCGA

  A2: AATGCCAATTCCATAGGATTAAATCGA

  A3: AATGCCAATTCCATAGGATTAAATCGA

  A4: AATGCCAATTCCATAGGATTAAATCGA

  ‘So you see, entire segments of the DNA can be exactly the same. Four identical single-cell organisms.’ She put down the sheet and picked up another. ‘But instead we got this.’

  A1: AATGCCA CGATGCTACCTG AAATCGA

  A2: AATGCCA ATTCCATAGGATT AAATCGA

  A3: AATGCCA GGAAATTACCCG AAATCGA

  A4: AATGCCA TTTGGAACAAAT AATCGA

 
; ‘Those are the base sequences of four amplicons from four of our jelly organisms. The DNA looks identical - until you hit brief hypervariable segments, where it all goes haywire. There’s no pattern whatsoever. We’ve examined dozens of cells. Some differ only marginally in the hypervariable sections, but others are radically different. It can’t be accounted for by the background mutation rate. In other words, the variations aren’t coincidental.’

  ‘Maybe this isn’t a single species, after all,’ said Anawak.

  ‘No, it’s definitely the same species. And there’s definitely no way an organism can change its genetic coding in the course of its lifetime. The design plan comes first. Organisms are built according to their design plan, and once they’re built, they correspond to that plan and no other.’

  There was a long silence.

  ‘But if, in spite of all that, the cells are still different,’ said Anawak, ‘they must have found a way of changing their DNA after they divided.’

  ‘But for what purpose?’ asked Delaware.

  ‘A human purpose,’ said Vanderbilt.

  ‘Human?’

  ‘Are you all deaf or something? Nature doesn’t do this stuff. That’s what Dr Oliviera said, and I haven’t heard any objection from Dr Johanson. So who’s got the nerve to cook this shit up? Those jelly cells are a biological weapon. Only humans could do a thing like this.’

  ‘In that case, objection,’ said Johanson. He ran his hand through his hair. ‘It doesn’t make sense, Jack. The advantage of biological weaponry is that you only need one recipe. Reproduction takes care of the rest.’

  ‘But surely it’s an advantage when a virus mutates. The AIDS virus is mutating all the time. Whenever we start to get wise to it, hey presto, it’s changed its form.’

  ‘That’s different. We’re dealing here with a superorganism, not a virological infection. There’s got to be some other explanation as to why the cells are different. Something happens to their DNA after they divide. They’re coded differently. Who cares what’s responsible for making them do that? We need to find out why.’

  ‘To kill us, of course,’ Vanderbilt said angrily. ‘The purpose of this gunk is to destroy the democratic world.’

  ‘OK then,’ growled Johanson, ‘why don’t you shoot it? I mean, maybe they’re Islamic cells. Extremist DNA. That would make sense.’

  Vanderbilt stared at him. ‘Whose side are you on?’

  ‘The side of understanding.’

  ‘Well, I’m not sure I understand how you came to fall over last night’ Vanderbilt gave a smug smile. ‘Maybe it had something to do with that bottle of Bordeaux…How are you feeling, Dr Johanson? Is your head OK? Maybe you should shut up and listen for a while.’

  ‘Not if it means you doing all the talking.’

  Vanderbilt wheezed. He was sweating profusely. Li shot him a scornful look from the corner of her eye and leaned forward. ‘You say that they’re coded differently, right?’

  ‘Right.’ Oliviera nodded.

  ‘I’m no scientist, but wouldn’t it be possible that their coding serves the same purpose as any type of human code? Like military passwords, for instance.’

  ‘Yes.’ Oliviera nodded again. ‘That would be possible.’

  ‘Passwords that allow them to recognise each other.’

  Weaver scribbled something on a scrap of paper and pushed it in Anawak’s direction. He read it, gave a quick nod and laid it aside.

  ‘Why would they need to recognise each other?’ asked Rubin. ‘And why use such an intricate method?’

  ‘I’d have thought that was obvious,’ said Crowe.

  For a moment the only sound was the rustling of Cellophane as she unwrapped a pack of cigarettes.

  ‘What do you mean?’ asked Li.

  ‘I’d say it’s for communication,’ said Crowe. ‘The cells are communicating with each other. It’s a kind of conversation.’

  ‘You mean this stuff…’ Greywolf stared at her.

  Crowe held the lighter to the end of her cigarette, took a drag and exhaled. ‘It’s exchanging information.’

  Vehicle Ramp

  ‘Whatever happened to you last night?’ asked Oliviera, as they made their way down to the lab.

  Johanson shrugged. ‘I haven’t the faintest idea.’

  ‘And how are you feeling now?’

  ‘A bit weird. The headache’s getting better, but I’ve got a hole in my memory about the size of the hangar bay.’

  ‘Bad luck, eh?’ Rubin glanced back at them. His teeth showed as he smiled. ‘Who’d have thought we’d both end up with a headache? What a pair of invalids. I felt so rotten last night that I couldn’t even get out of bed to let you know what was wrong. I can’t apologise enough. But when you feel a migraine coming on like that…Wham! It just hits you. I was out for the count.’

  Oliviera fixed Rubin with an unfathomable look. ‘A migraine, was it?’

  ‘It comes and goes. It doesn’t happen too often, but when I get one, there’s nothing I can do. It’s enough trouble just to swallow my tablets and turn out the lights.’

  ‘And you didn’t wake up until this morning?’

  ‘Yeah.’ Rubin looked at her guiltily. ‘I’m sorry, but a migraine knocks me out. Normally I’d have at least popped down to the lab…’

  ‘But you stayed in bed?’

  Rubin gave her a vexed smile. ‘Yes.’

  ‘Are you sure?’

  ‘Well, I should know.’

  Something clicked in Johanson’s head. It was like a broken projector: the carousel kept trying to drop a slide into position, but something was sticking.

  They stopped in front of the door to the lab, and Rubin punched in the code. The door swung open. As Rubin walked inside and turned on the lights, Oliviera whispered to Johanson, ‘What’s up? You were the one who swore blind you’d seen him last night.’

  Johanson stared at her. ‘Was I?’

  ‘You know,’ murmured Oliviera. ‘We were sitting on that crate, drinking wine and waiting for the sequencer to finish. You said you’d seen him.’

  Click. The carousel tried to release the slide. Click.

  His mind felt woolly. He could remember drinking a glass of wine. And they’d talked for a bit. And then he’d…He’d seen something?

  Click.

  Oliviera raised her eyebrows. ‘My God,’ she said. ‘That must have been quite some blow to the head.’

  Neural Network Computer

  They were sitting in the JIC at Weaver’s computer. ‘OK,’ she said. ‘This stuff about the coding puts an entirely new spin on things.’

  Anawak nodded. ‘The cells aren’t identical. They’re not like neurons.’

  ‘So it’s not just a case of how they’re connected. If their DNA contains individually coded sequences, maybe that’s their secret. It could be how they aggregate.’

  ‘No, there has to be another trigger - something that can work over distance.’

  ‘Well, yesterday we were talking about scent.’

  ‘OK,’ said Anawak. ‘Give it a go. Program the units so they can secrete a scent that tells them to aggregate.’

  Weaver thought for a moment. She picked up the phone and used the intercom to dial the lab. ‘Sigur? Hi. We’re working on the computer simulation. Any new ideas about how these cells are aggregating?’ She listened for a while. ‘Fine. We’ll try that…OK. Let me know.’

  ‘What did he say?’ asked Anawak.

  ‘They’re doing a phase test. They’re trying to get the jelly to dissociate, then band back together.’

  ‘So they agree that the cells could be using a scent?’

  ‘Yes.’ Weaver wrinkled her nose. ‘The trouble is, which cell would secrete the scent first? And why? If it’s a chain reaction, it has to start somewhere.’

  ‘It could be a genetic program,’ mused Anawak. ‘You know, with only particular cells capable of triggering aggregation.’

  ‘So one part of the brain would have an inbuilt capacity to do mor
e than the rest…’ Weaver mused. ‘It’s an interesting idea. But I’m not sure it’s right.’

  ‘Hold on a minute - what if we’re still on the wrong track? We’re working on the assumption that the cells form a brain when they aggregate.’

  ‘I’m almost certain they do.’

  ‘Well, so am I. But it’s just occurred to me that…’

  ‘What?’

  Anawak was thinking feverishly. ‘Don’t you find it odd that the cells are all different? To my mind, there’s only one reason why the coding would be variable - their DNA has been programmed separately to enable them to accomplish different tasks. But if that were the case, each of those cells would be a brain in itself.’ He stopped to think again. That would be amazing. But he didn’t have the first clue how it might work. ‘In fact, the DNA in each cell would actually be the brain.’

  ‘Intelligent DNA?’

  ‘Er, yes.’

  ‘But it would have to be able to learn.’ She looked at him doubtfully. ‘I’m prepared to believe almost anything, but isn’t that a bit…?’

  She was right. It was a crazy idea. It would involve a new type of biochemistry. Something they knew nothing about. But if there was a way of making it work…‘Can you tell me again how neural network computers actually learn?’ he said.

  ‘It’s through parallel distributed processing. The computer learns from example. The more input patterns it encounters, the more output patterns it predicts.’

  ‘And how does it retain that information?’

  ‘It stores it.’

  ‘So every unit has to have storage space. And the network of storage units produces artificial thought.’

  ‘What are you getting at?’

  Anawak explained. She listened, then made him start again from the beginning. ‘But aren’t you rewriting the laws of biology?’

  ‘I guess so. But couldn’t you write a program that works in a similar fashion?’

  ‘Oh, God.’

  ‘A smaller version, then.’

  ‘Even that’s a tall order. Christ, Leon, what a crazy theory. But, OK, I’ll do it.’